Dataset for CDS classical BH3-containing proteins of organism Poecilia mexicana

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B3YFR1_BAD-01       atgga---------------------------------------------
A0A3B3YII5_BCL2L11      atgcactctttaagaccgccaaatctgctcgatggctcgaccgaagtaac
A0A3B3YII5_BCL2L11      atgcactctttaagaccgccaaatctgctcgatggctcgaccgaagtaac
A0A3B3WU80_BMF-01       atgga---------------------------------------------
                        *** *                                             

A0A3B3YFR1_BAD-01       --------------------------------------cgcaaaatttac
A0A3B3YII5_BCL2L11      gccagcagaggggaccggcggagacccagcatcgtcagcgcgaacaccac
A0A3B3YII5_BCL2L11      gccagcagaggggaccggcggagacccagcatcgtcagcgcgaacaccac
A0A3B3WU80_BMF-01       ---ggatgaggaggatgatg------------tgtttgagc---------

A0A3B3YFR1_BAD-01       aattt----------caga---cagcgactcggagccatc----------
A0A3B3YII5_BCL2L11      gttcctcgaagcacacagagcggagctgcgcgccgcaggcgggcgcctcc
A0A3B3YII5_BCL2L11      gttcctcgaagcacacagagcggagctgcgcgccgcaggcgggcgcctcc
A0A3B3WU80_BMF-01       ---------------cagatcccaactgc-tggcgcacgc-----ccttc
                                       ****    * *  *  *  **   *          

A0A3B3YFR1_BAD-01       ------ggaagacgtagaggaaagaggaaacttgcagctaatgcaagtaa
A0A3B3YII5_BCL2L11      acagccgggggaggaggaggagggggagga------------ggaggaag
A0A3B3YII5_BCL2L11      acagccgggggaggaggaggagggggagga------------ggaggaag
A0A3B3WU80_BMF-01       a-----gggagataaagtgtgaagaccggg------------gcacgcag
                              **  **    * *    *                  * * * * 

A0A3B3YFR1_BAD-01       aggagaggccgctcag---tcaacgccacaccc-----------------
A0A3B3YII5_BCL2L11      aggggagccggattcggactcgccgccgtgctccgtgagcccggccagtt
A0A3B3YII5_BCL2L11      aggggagccggattcggactcgccgccgtgctccgtgagcccggccagtt
A0A3B3WU80_BMF-01       a----cgcccggtccgggccaggcgctacacaacggcatgctgccctgtg
                        *     * * * *  *       ***    *                   

A0A3B3YFR1_BAD-01       ----------------------------tcacgcttcctgagctccgatc
A0A3B3YII5_BCL2L11      tagacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtcc
A0A3B3YII5_BCL2L11      tagacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtcc
A0A3B3WU80_BMF-01       -----gtgttgcggaggag----------------cccagacgactattc
                                                            ** *         *

A0A3B3YFR1_BAD-01       tacaacaggtc--------gggtgagactgaactcggagtccatcgcttc
A0A3B3YII5_BCL2L11      agcggatacttctccttt-gactgcgactcgctgccgagctccccgctct
A0A3B3YII5_BCL2L11      agcggatacttctccttt-gactgcgactcgctgccgagctccccgctct
A0A3B3WU80_BMF-01       tacggtaacgcaggttttcgattgcacttcccagc---gcattttgaact
                          *                *  **    *     *   *      *    

A0A3B3YFR1_BAD-01       caccatctccagagaggaggagctgcaggccagggggg------------
A0A3B3YII5_BCL2L11      ctccgcacccagtgacggctgaca--aagccacgcagacccccagcccca
A0A3B3YII5_BCL2L11      ctccgcacccagtgacggctgaca--aagccacgcagacccccagcccca
A0A3B3WU80_BMF-01       tgtcggggattttgacgcgaggcaacaagaggagcaga------------
                           *         ** *     *   * *    *  *             

A0A3B3YFR1_BAD-01       -----aagaggaggtcgggacccccactgag---ggcttt-----ccatt
A0A3B3YII5_BCL2L11      ccggccaggtgatgaaccacgccctgcagcgaatggctgtggagcacgg-
A0A3B3YII5_BCL2L11      ccggccaggtgatgaaccacgccctgcagcgaatggctgtggagcacgg-
A0A3B3WU80_BMF-01       ---acaggatggagcagttacccctgcaccagccggctgc---actcagc
                               *  *  *       ***  *       ****        *   

A0A3B3YFR1_BAD-01       caggggccgatctaattcagctcccccctccct-----------------
A0A3B3YII5_BCL2L11      -tggactcgggctgcacgggcactctcccaaccactatagcactattaac
A0A3B3YII5_BCL2L11      -tggactcgggctgcacgggcactctcccaaccactatagcactattaac
A0A3B3WU80_BMF-01       ttgga---ggcctgcatcgg------------------------------
                          **    *  **      *                              

A0A3B3YFR1_BAD-01       -----gtgggccgccaag------aagtatggccggcagcttcggaggat
A0A3B3YII5_BCL2L11      gcggcgcgggatatgcagtcagaaaactttggtcgtcaactccgtgctat
A0A3B3YII5_BCL2L11      gcggcgcgggatatgcagtcagaaaactttggtcgtcaactccgtgctat
A0A3B3WU80_BMF-01       -----gcagaagcttcag----------ctgataggcgac-cagtttcac
                             *  *       **           **   * *  *   *    * 

A0A3B3YFR1_BAD-01       gagcgatgagtttgtca--acctgcttgataaaggggaaatgaggaaggt
A0A3B3YII5_BCL2L11      tggagatgactacaaca--accacctgatgaggatggcgagaagacacca
A0A3B3YII5_BCL2L11      tggagatgactacaaca--accacctgatgaggatggcgagaagacacca
A0A3B3WU80_BMF-01       cgggaacacttacaacagtaccaac------------------aaaacca
                          *  *    *    **  ***  *                     *   

A0A3B3YFR1_BAD-01       gagcagtaccgggtcgaacagaccgatacaccac----tccaggagctgg
A0A3B3YII5_BCL2L11      acggaatatagtccctctaaacctgatgccacacatccagcaagagcctg
A0A3B3YII5_BCL2L11      acggaatatagtccctctaaacctgatgccacacatccagcaagagcctg
A0A3B3WU80_BMF-01       aaggaatcaggggccgctg----tggtggcgcat-----------gactg
                          * * *   *   *         * *    **            *   *

A0A3B3YFR1_BAD-01       tggagctacctct--tcagtcaccag----------------gagacgga
A0A3B3YII5_BCL2L11      ttgccatgctttgtgtctgccttctgctcc---------tcctggtcgga
A0A3B3YII5_BCL2L11      ttgccatgctttgtgtctgccttctgctcc---------tcctggtcgga
A0A3B3WU80_BMF-01       cagctcttc------tcagcctcctgtttcatagggggtttattgctgga
                          *   * *      ** * *  * *                  *  ***

A0A3B3YFR1_BAD-01       gggagag-------aacaaccaccacga-aaaccacgcctcccgcaccga
A0A3B3YII5_BCL2L11      cgaataatgtacatgcaaggcaacacaagcagccacgaccactctcaggt
A0A3B3YII5_BCL2L11      cgaataatgtacatgcaaggcaacacaagcagccacgaccactctcaggt
A0A3B3WU80_BMF-01       ggag----------gtggagcaggacgg------------------aggt
                         *                  **  **                      * 

A0A3B3YFR1_BAD-01       gtag
A0A3B3YII5_BCL2L11      ttag
A0A3B3YII5_BCL2L11      ttag
A0A3B3WU80_BMF-01       ga--

© 1998-2020Legal notice