Dataset for CDS classical BH3-containing proteins of organism Poecilia latipinna

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B3UA11_BAD-01       atggacgcaaaatttacaatttcagacagcga------ctcggagccatc
A0A3B3VNE0_BCL2L11      atgcactc-----------ttcaagaccgccaaatctgctcgatggc-tc
                        *** ** *           **  **** ** *      ****  * * **

A0A3B3UA11_BAD-01       ggaagacgtagaggaa--agaggaaacttgcagctaatgcaagtaaagga
A0A3B3VNE0_BCL2L11      gaccgaagtaacgccagcagaggggaccggc----------------gga
                        *   ** ***  *  *  *****  **  **                ***

A0A3B3UA11_BAD-01       gaggccgctcagtcaacgc-cacaccctcacgcttcctgagctccgatct
A0A3B3VNE0_BCL2L11      gacccagcatcgtcagcgcgaacac---cacgttcctcga----------
                        **  * **   **** ***  ****   **** * *  **          

A0A3B3UA11_BAD-01       acaacaggtcgggtgagactgaac-tcggagtccatcgcttccaccatct
A0A3B3VNE0_BCL2L11      --agcacacagagcggagctgcgcgccgcagacgggcgcctccacagccg
                          * **    * * *   ***  *  ** ** *   *** *****   * 

A0A3B3UA11_BAD-01       ccagagaggaggagctgcaggccaggggggaagaggaagtcgggaccccc
A0A3B3VNE0_BCL2L11      --ggggaggaggaggaggaggagggggaggaggaggggagccggacgcgg
                           * *********  * ***   *** *** ****    * **** *  

A0A3B3UA11_BAD-01       act--------------------------------gagggctttccattc
A0A3B3VNE0_BCL2L11      attcgccgccgtgctccgtgagcccggccagtttagacgtctttcgaagc
                        * *                                ** * ***** *  *

A0A3B3UA11_BAD-01       aggg------------------gccgatc----------taattc-----
A0A3B3VNE0_BCL2L11      aggtcgatatttcgccctccccgccgctcgtccagcggatacttctcctt
                        ***                   **** **          ** ***     

A0A3B3UA11_BAD-01       -------------------agctcccccctccct----------------
A0A3B3VNE0_BCL2L11      tgactgcgactcgctgccgagctccccgctctctccgcacccagtgacgg
                                           ******** *** **                

A0A3B3UA11_BAD-01       -------------gtgggccgccaa------------------gaagtac
A0A3B3VNE0_BCL2L11      ctgataaagccacgcagacccccagccccaccggccaggtgatgaaccac
                                     *  * ** ***                   ***  **

A0A3B3UA11_BAD-01       ggccggcagc-----------------------ttcgg------------
A0A3B3VNE0_BCL2L11      gccctgcagcgaatggctgtggagcacggtggactcgggctgcacgggca
                        * ** *****                        ****            

A0A3B3UA11_BAD-01       -----------------------------------aggatgagcgatga-
A0A3B3VNE0_BCL2L11      ctctcccaaccactatagcactattaacgcggcgcgggatatgcagtcag
                                                            ****  **  * * 

A0A3B3UA11_BAD-01       --------gtttgtcaacctgcttgataaagggga---------------
A0A3B3VNE0_BCL2L11      aaacctttggtcgtcaa-ctccgtgctattggagatgactacaacaacca
                                * * ***** ** * ** **  ** **               

A0A3B3UA11_BAD-01       ---------aatgaggaaggtgagcagtaccgggtcgaacaga-------
A0A3B3VNE0_BCL2L11      cctgatggtaaggaggatggcgagaagacaccaacggaatatagtccctc
                                 ** ***** ** *** **   *     *** * *       

A0A3B3UA11_BAD-01       -----ccgatacaccac-tccag---gagctggtggagctacct------
A0A3B3VNE0_BCL2L11      taaacctgatgccgcacatccagcaagagcctgttgccatgctttgtgtc
                             * *** *  *** *****   ****  ** *   * * *      

A0A3B3UA11_BAD-01       ---cttcagtcaccaggagacggagggaga--gaacaacca---ccacga
A0A3B3VNE0_BCL2L11      tgccttctgctcctcctggtcggacgaataatgtacatgcaaggcaacac
                           **** *   *     * **** * * *  * ***  **   * **  

A0A3B3UA11_BAD-01       aaaccacgcctcccgcaccgag---tag
A0A3B3VNE0_BCL2L11      aagcagccacgaccactctcaggtttag
                        ** *  *  *  ** * *  **   ***

© 1998-2020Legal notice