Dataset for CDS classical BH3-containing proteins of organism Podarcis muralis

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A670JUY4_BAD-01       --------------------------------------------------
A0A670KEZ9_BCL2L11      ----atggcaaaacaatcttctgatttaact-------------tctgag
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A670JUU6_BMF-01       atgaattcctatatagaagtcacattaacctcagtgggaatggacttatt
A0A670JUU6_BMF-05       --------------------------------------------------
A0A670JUU6_BMF-04       atgaattcctatatagaagtcacattaacctcagtgggaatggacttatt
A0A670JUU6_BMF-02       --------------------------------------------------
A0A670JUU6_BMF-03       --------------------------------------------------

A0A670JUY4_BAD-01       ----------------------------ctggagtttaataacatcag--
A0A670KEZ9_BCL2L11      tgcggtagagagggtggacaattgcagcctgctgaaaggccagctcagca
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A670JUU6_BMF-01       tccaggtgaaatggattcccctgactacctggaggaggatttctccaatc
A0A670JUU6_BMF-05       ----------atggattcccctgactacctggaggaggatttctccaatc
A0A670JUU6_BMF-04       tccaggtgaaatggattcccctgactacctggaggaggatttctccaatc
A0A670JUU6_BMF-02       ----------atggattcccctgactacctggaggaggatttctccaatc
A0A670JUU6_BMF-03       ----------atggattcccctgactacctggaggaggatttctccaatc

A0A670JUY4_BAD-01       --aaaggactgga---------ccttggccttgggcact-----------
A0A670KEZ9_BCL2L11      tcttcggcctggg-----gcccctacctccttacaaactgtgtac-----
A0A670IXL8_PMAIP1-      ------------------atgccctcc-----------------------
A0A670JUU6_BMF-01       tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc
A0A670JUU6_BMF-05       tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc
A0A670JUU6_BMF-04       tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc
A0A670JUU6_BMF-02       tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc
A0A670JUU6_BMF-03       tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc

A0A670JUY4_BAD-01       ----------------------ttccgggcacgctcacgctctg------
A0A670KEZ9_BCL2L11      ---caaggtaatcattcgggcgagcgggacacttcatcacccagtagccc
A0A670IXL8_PMAIP1-      ---cagcgccttgaa-----------------------------------
A0A670JUU6_BMF-01       agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc
A0A670JUU6_BMF-05       agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc
A0A670JUU6_BMF-04       agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc
A0A670JUU6_BMF-02       agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc
A0A670JUU6_BMF-03       agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc

A0A670JUY4_BAD-01       ----------------------------------cccctcccatcctgtg
A0A670KEZ9_BCL2L11      tcaggga---------------------------ccactggcaccaccct
A0A670IXL8_PMAIP1-      ctacaac-------------------------tcccac------------
A0A670JUU6_BMF-01       ttacaactgccttctggggagattccagctcttcccacttacacactgtt
A0A670JUU6_BMF-05       ttacaactgccttctggggagattccagctcttcccacttacacactgtt
A0A670JUU6_BMF-04       ttacaactgccttctggggagattccagctcttcccacttacacactgtt
A0A670JUU6_BMF-02       ttacaactgccttctggggagattccagctcttcccacttacacactgtt
A0A670JUU6_BMF-03       ttacaactgccttctggggagattccagctcttcccacttacacactgtt
                                                          ** *            

A0A670JUY4_BAD-01       ggcagcccagc---------------------------------------
A0A670KEZ9_BCL2L11      ccagccccagtccgtttgctaccagatccccgttgttcatatttgtaaga
A0A670IXL8_PMAIP1-      -cagccccagc---------------------------------------
A0A670JUU6_BMF-01       gcggcccaggcaccaggcatgccaa-------------------gcagca
A0A670JUU6_BMF-05       gcggcccaggcaccaggcatgccaa-------------------gcagca
A0A670JUU6_BMF-04       gcggcccaggcaccaggcatgccaa-------------------gcagca
A0A670JUU6_BMF-02       gcggcccaggcaccaggcatgccaa-------------------gcagca
A0A670JUU6_BMF-03       gcggcccaggcaccaggcatgccaa-------------------gcagca
                             **  *                                        

A0A670JUY4_BAD-01       --------------------------------------------------
A0A670KEZ9_BCL2L11      agatccccactgctgtccagatcctccagtgggtatttctcttttgacac
A0A670IXL8_PMAIP1-      --------------------atccacaaccaa-----t------------
A0A670JUU6_BMF-01       agat----aaggcaactcaaaccctcaaccca-----tcctcttctagcc
A0A670JUU6_BMF-05       agat----aaggcaactcaaaccctcaaccca-----tcctcttctagcc
A0A670JUU6_BMF-04       agat----aaggcaactcaaaccctcaaccca-----tcctcttctagcc
A0A670JUU6_BMF-02       agat----aaggcaactcaaaccctcaaccca-----tcctcttctagcc
A0A670JUU6_BMF-03       agat----aaggcaactcaaaccctcaaccca-----tcctcttctagcc

A0A670JUY4_BAD-01       ---------------------ggtatgggagggagctgcgcaggat----
A0A670KEZ9_BCL2L11      cgacaggagtcctgcacctatgagttgcgacaaggccacacagactc---
A0A670IXL8_PMAIP1-      ------------------------------------------gactc---
A0A670JUU6_BMF-01       aggatgtcatgttaccttgtggagtcactgaagagccccagagactcttc
A0A670JUU6_BMF-05       aggatgtcatgttaccttgtggagtcactgaagagccccagagactcttc
A0A670JUU6_BMF-04       aggatgtcatgttaccttgtggagtcactgaagagccccagagactcttc
A0A670JUU6_BMF-02       aggatgtcatgttaccttgtggagtcactgaagagccccagagactcttc
A0A670JUU6_BMF-03       aggatgtcatgttaccttgtggagtcactgaagagccccagagactcttc
                                                                  *  *    

A0A670JUY4_BAD-01       -----gagcgacgaattcc------atggcgagc----------------
A0A670KEZ9_BCL2L11      -----------cgagtccc----ccgtgtcaagccttcagtcattatcta
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A670JUU6_BMF-01       tatgggaacgccgggttccgtttacatgtcaaccccattggtttctcatt
A0A670JUU6_BMF-05       tatgggaacgccgggttccgtttacatgtcaaccccattggtttctcatt
A0A670JUU6_BMF-04       tatgggaacgccgggttccgtttacatgtcaaccccattggtttctcatt
A0A670JUU6_BMF-02       tatgggaacgccgggttccgtttacatgtcaaccccattggtttctcatt
A0A670JUU6_BMF-03       tatgggaacgccgggttccgtttacatgtcaaccccattggtttctcatt

A0A670JUY4_BAD-01       ------------tgcagaag-------ctgccgcgccccaagagtgcagg
A0A670KEZ9_BCL2L11      agcgcaatggcttacagatggcagtcacggtcaatccctgaagatatacg
A0A670IXL8_PMAIP1-      ---------------ggagg--cggtacgggaatg---------------
A0A670JUU6_BMF-01       gagtccacacctccgggagg--aacctcgggaaagcccacaggaactgcg
A0A670JUU6_BMF-05       gagtccacacctccgggagg--aacctcgggaaagcccacaggaactgcg
A0A670JUU6_BMF-04       gagtccacacctccgggagg--aacctcgggaaagcccacaggaactgcg
A0A670JUU6_BMF-02       gagtccacacctccgggagg--aacctcgggaaagcccacaggaactgcg
A0A670JUU6_BMF-03       gagtccacacctccgggagg--aacctcgggaaagcccacaggaactgcg
                                        ** *       * *                    

A0A670JUY4_BAD-01       gacagctacccaaatgcgccggacgttgggctggaaggagg---------
A0A670KEZ9_BCL2L11      gccagaaatatggattgcacgggaattacagcgcattggagatgaattta
A0A670IXL8_PMAIP1-      ---------------tgcattgcagctacgcaggatgggggacaaatgga
A0A670JUU6_BMF-01       aactgaagttcagattgcacggaagttacagtgcattgcggaccagtttc
A0A670JUU6_BMF-05       aactgaagttcagattgcacggaagttacagtgcattgcggaccagtttc
A0A670JUU6_BMF-04       aactgaagttcagattgcacggaagttacagtgcattgcggaccagtttc
A0A670JUU6_BMF-02       aactgaagttcagattgcacggaagttacagtgcattgcggaccagtttc
A0A670JUU6_BMF-03       aactgaagttcagattgcacggaagttacagtgcattgcggaccagtttc
                                             *    *     * *  *  *         

A0A670JUY4_BAD-01       -----ttctgcagtcatgg-------------------------------
A0A670KEZ9_BCL2L11      atgcttcctacagtccgag-------------------------------
A0A670IXL8_PMAIP1-      ac---ctgcgc---cagaa-------------------------------
A0A670JUU6_BMF-01       acaggctgcacctacagag-------------------------------
A0A670JUU6_BMF-05       acaggctgcacctacagag-------------------------------
A0A670JUU6_BMF-04       acaggctgcacctacagaggatttgcatgaaggatctgcattttccactg
A0A670JUU6_BMF-02       acaggctgcacctacagaggatttgcatgaaggatctgcattttccactg
A0A670JUU6_BMF-03       acaggctgcacctacagag-------------------------------
                                  *   *                                   

A0A670JUY4_BAD-01       --------------------------------------------------
A0A670KEZ9_BCL2L11      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A670JUU6_BMF-01       ----------------------------------gcaccagcagaacc--
A0A670JUU6_BMF-05       ----------------------------------gcaccagcagaacc--
A0A670JUU6_BMF-04       ctgtctgtgaagattaaggtccgttttcctccccgtatcctcagcacttg
A0A670JUU6_BMF-02       ctgtctgtgaagattaaggtccgttttcctccccgtatcctcagcacttg
A0A670JUU6_BMF-03       --------------------------------------------------

A0A670JUY4_BAD-01       ------------------------------------tggcgtcggaattc
A0A670KEZ9_BCL2L11      ------------------aaggggtttcttggattaccaagcagtaaacc
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A670JUU6_BMF-01       ---------------gaaaccaggtctggtgg------------------
A0A670JUU6_BMF-05       ---------------gaaaccaggtctggtgg------------------
A0A670JUU6_BMF-04       ttcagctgttggtaagaaaaaagggatggtgaggtttgaaagag-----c
A0A670JUU6_BMF-02       ttcagctgttggtaagaaaaaagggatggtgaggtttgaaagag-----c
A0A670JUU6_BMF-03       --------------------------------------------------

A0A670JUY4_BAD-01       cccaggcaat----------------------------------------
A0A670KEZ9_BCL2L11      accagatcat---------------aattttgcgcctgttgcattacatc
A0A670IXL8_PMAIP1-      ----gatcct----------------------------------------
A0A670JUU6_BMF-01       --cagatcct------------------------------ccttttcctc
A0A670JUU6_BMF-05       --cagatcct------------------------------ccttttcctc
A0A670JUU6_BMF-04       tctggatcctcaaagagagggtacatacactcaggcaaacc-----ccac
A0A670JUU6_BMF-02       tctggatcctcaaagagagggtacatacactcagctttatccatggccac
A0A670JUU6_BMF-03       ---------------------------------gctttatccatggccac

A0A670JUY4_BAD-01       --------------------------------------------------
A0A670KEZ9_BCL2L11      gtccgcctcatatggag---------------------------------
A0A670IXL8_PMAIP1-      --caacctg-----------------------------------------
A0A670JUU6_BMF-01       cataacgtggcgttgaacatgg--------------------------ag
A0A670JUU6_BMF-05       cataacgtggcgttgaacatgg--------------------------ag
A0A670JUU6_BMF-04       tacgggaagtgaaggaactctgtggagaaagagaatgttgcaaacaacag
A0A670JUU6_BMF-02       t-cagcctgaaacgggactctgctggg--------------------cgg
A0A670JUU6_BMF-03       t-cagcctgaaacgggactctgctggg--------------------cgg

A0A670JUY4_BAD-01       ------------------------------------ggtccaagaagccc
A0A670KEZ9_BCL2L11      ------------------------------------aatgca--------
A0A670IXL8_PMAIP1-      ------------------------------------atttcaaag----c
A0A670JUU6_BMF-01       gccaacagacacca-cgc------------------gggtcggagcttta
A0A670JUU6_BMF-05       gccaacagacacca-cgc------------------gggtcggag-----
A0A670JUU6_BMF-04       atggaggagttttggagcaggaggtgcaccctaggaagcccacggaacac
A0A670JUU6_BMF-02       ccgaaaaggctccagtgc-----ttgtctcc-----agctcagaggacac
A0A670JUU6_BMF-03       ccgaaaaggctccagtgc-----ttgtctcc-----agctcagaggacac

A0A670JUY4_BAD-01       ccc-------------atga
A0A670KEZ9_BCL2L11      ----------------gtga
A0A670IXL8_PMAIP1-      ttttctgccccgaaacgtga
A0A670JUU6_BMF-01       tccatggccactcagcctga
A0A670JUU6_BMF-05       ----------------gtga
A0A670JUU6_BMF-04       -gtaatac----caaaataa
A0A670JUU6_BMF-02       tgtggtgcatctctgaatga
A0A670JUU6_BMF-03       tgtggtgcatctctgaatga
                                         * *

© 1998-2021Legal notice