Dataset for CDS BCL2L11 of organism Piliocolobus tephrosceles

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9I5G9_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A8C9I5G9_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A8C9I5G9_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A8C9I5G9_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A8C9I5G9_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A8C9I5G9_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A8C9I5G9_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A8C9I5G9_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A8C9I5G9_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A8C9I5G9_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A8C9I5G9_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A8C9I5G9_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                        **************************************************

A0A8C9I5G9_BCL2L11      cctccctacagacagaaccacaa---------------------------
A0A8C9I5G9_BCL2L11      cctccctacagacagaaccacaa---------------------------
A0A8C9I5G9_BCL2L11      cctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggt
A0A8C9I5G9_BCL2L11      cctccctacagacagaaccaca----------------------------
A0A8C9I5G9_BCL2L11      cctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggt
A0A8C9I5G9_BCL2L11      cctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggt
                        **********************                            

A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A8C9I5G9_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                                                                          

A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A8C9I5G9_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
                                                                          

A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8C9I5G9_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                                                                          

A0A8C9I5G9_BCL2L11      ---gacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A8C9I5G9_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A8C9I5G9_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A8C9I5G9_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                                                                          

A0A8C9I5G9_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtta
A0A8C9I5G9_BCL2L11      -------------------------------------------gc-----
A0A8C9I5G9_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
A0A8C9I5G9_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
A0A8C9I5G9_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
A0A8C9I5G9_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
                                                                   *      

A0A8C9I5G9_BCL2L11      tcctagaggatatgggtgatacttcat-tgtg-gtttggatttatattta
A0A8C9I5G9_BCL2L11      ttccaggaggca-ggccgaacctgcagatatgcgcccgga--gatacgga
A0A8C9I5G9_BCL2L11      ttccaggaggca-ggccgaacctgcagatatgcgcccgga--gatacgga
A0A8C9I5G9_BCL2L11      ttccaggaggca-ggccgaacctgcagatatgcgcccgga--gatacgga
A0A8C9I5G9_BCL2L11      ttccaggaggca-ggccgaacctgcagatatgcgcccgga--gatacgga
A0A8C9I5G9_BCL2L11      ttccaggaggca-ggccgaacctgcagatatgcgcccgga--gatacgga
                        * * **  *  * **  **  ** **  * ** *   ***   ***   *

A0A8C9I5G9_BCL2L11      ctggcttagatttgtatggccaccaccacagtcaagatacagaacaactc
A0A8C9I5G9_BCL2L11      tcgcccaagagttg--cggcga--atcggagacgagtttaacgcttacta
A0A8C9I5G9_BCL2L11      tcgcccaagagttg--cggcga--atcggagacgagtttaacgcttacta
A0A8C9I5G9_BCL2L11      tcgcccaagagttg--cggcga--atcggagacgagtttaacgcttacta
A0A8C9I5G9_BCL2L11      tcgcccaagagttg--cggcga--atcggagacgagtttaacgcttacta
A0A8C9I5G9_BCL2L11      tcgcccaagagttg--cggcga--atcggagacgagtttaacgcttacta
                          * *  *** ***   *** *  * *  ** * ** *  *     *** 

A0A8C9I5G9_BCL2L11      aaccacagggat--------------------------------------
A0A8C9I5G9_BCL2L11      tgcaaggaggttg-------------------------------------
A0A8C9I5G9_BCL2L11      tgcaaggagggtatttttgaataattaccaagcagccgaagaccacccac
A0A8C9I5G9_BCL2L11      tgcaaggagggtatttttgaataattaccaagcagccgaagaccacccac
A0A8C9I5G9_BCL2L11      tgcaaggaggatgtctct--------------------------------
A0A8C9I5G9_BCL2L11      tgcaaggaggtt--------------------------------------
                          * *   ** *                                      

A0A8C9I5G9_BCL2L11      ---------------------------------ttctcatg---------
A0A8C9I5G9_BCL2L11      ---------------gcaaaactcctggcatcctccacctg---------
A0A8C9I5G9_BCL2L11      aaatggttatcttacgactgttgcgttacattgtccgcctggtgtggaga
A0A8C9I5G9_BCL2L11      aaatggttatcttacgactgttgcgttacattgtccgcctggtgtggaga
A0A8C9I5G9_BCL2L11      ---------------------------------tccacctg---------
A0A8C9I5G9_BCL2L11      ------------------------------------agaga---------
                                                                          

A0A8C9I5G9_BCL2L11      --------a
A0A8C9I5G9_BCL2L11      --------a
A0A8C9I5G9_BCL2L11      atgcattga
A0A8C9I5G9_BCL2L11      atgcattga
A0A8C9I5G9_BCL2L11      ----attaa
A0A8C9I5G9_BCL2L11      ----aatag
                                 

© 1998-2022Legal notice