Dataset for CDS BCL2L11 of organism Physeter macrocephalus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2Y9T3Y6_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A2Y9T3Y6_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A2Y9T3Y6_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg

A0A2Y9T3Y6_BCL2L11      acaattgcagactgccgaaaggcctcctcagctcaggcctggggccccca
A0A2Y9T3Y6_BCL2L11      acaattgcagactgccgaaaggcctcctcagctcaggcctggggccccca
A0A2Y9T3Y6_BCL2L11      acaattgcagactgccgaaaggcctcctcagctcaggcctggggccccca

A0A2Y9T3Y6_BCL2L11      tctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgc
A0A2Y9T3Y6_BCL2L11      tctctctacagacagagcggca----------------------------
A0A2Y9T3Y6_BCL2L11      tctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgc

A0A2Y9T3Y6_BCL2L11      tgcccccaaggcagcccgcagggcccactggccccaccggccagtcccgg
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      tgcccccaaggcagcccgcagggcccactggccccaccggccagtcccgg

A0A2Y9T3Y6_BCL2L11      cccttttgctaccagatccccgcttttcatcttcgtgagaagatcttccc
A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      cccttttgctaccagatccccgcttttcatcttcgtgagaagatcttccc

A0A2Y9T3Y6_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A2Y9T3Y6_BCL2L11      ----------------------------------------agacaggagc
A0A2Y9T3Y6_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc

A0A2Y9T3Y6_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A2Y9T3Y6_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A2Y9T3Y6_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg

A0A2Y9T3Y6_BCL2L11      ccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
A0A2Y9T3Y6_BCL2L11      ccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
A0A2Y9T3Y6_BCL2L11      ccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc

A0A2Y9T3Y6_BCL2L11      aggctgtacctgcagatatgcgtccggagatatggattgcgcaagagttg
A0A2Y9T3Y6_BCL2L11      aggctgtacctgcagatatgcgtccggagatatggattgcgcaagagttg
A0A2Y9T3Y6_BCL2L11      aggctgtacctgcagatatgcgtccggagatatggattgcgcaagagttg

A0A2Y9T3Y6_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaaggaggtt------
A0A2Y9T3Y6_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaaggagggtctttct
A0A2Y9T3Y6_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaaggagggtctttct
                        ****************************************** *      

A0A2Y9T3Y6_BCL2L11      --------------------------------------------------
A0A2Y9T3Y6_BCL2L11      gaataatcaccaagcagccgaaggtcacccgcaaatggttatcttacgac
A0A2Y9T3Y6_BCL2L11      gaataatcaccaagcagccgaaggtcacccgcaaatggttatcttacgac

A0A2Y9T3Y6_BCL2L11      -------------------------------agagcaatag
A0A2Y9T3Y6_BCL2L11      tgttacgccacatcatccgtctggtgtggaggatgcagtga
A0A2Y9T3Y6_BCL2L11      tgttacgccacatcatccgtctggtgtggaggatgcagtga
                                                          *** *  

© 1998-2021Legal notice