Dataset for CDS BCL2L11 of organism Phocoena sinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9CBP3_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8C9CBP3_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8C9CBP3_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8C9CBP3_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
                        **************************************************

A0A8C9CBP3_BCL2L11      acaattgcagcctgccgaaaggcctcctcagctcaggcctggggccccca
A0A8C9CBP3_BCL2L11      acaattgcagcctgccgaaaggcctcctcagctcaggcctggggccccca
A0A8C9CBP3_BCL2L11      acaattgcagcctgccgaaaggcctcctcagctcaggcctggggccccca
A0A8C9CBP3_BCL2L11      acaattgcagcctgccgaaaggcctcctcagctcaggcctggggccccca
                        **************************************************

A0A8C9CBP3_BCL2L11      tctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgc
A0A8C9CBP3_BCL2L11      tctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgc
A0A8C9CBP3_BCL2L11      tctctctacagacagagcggca----------------------------
A0A8C9CBP3_BCL2L11      tctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgc
                        **********************                            

A0A8C9CBP3_BCL2L11      tgcccccaaggcagcccacagggcccactggccccaccggccagtcccgg
A0A8C9CBP3_BCL2L11      tgcccccaaggcagcccacagggcccactggccccaccggccagtcccgg
A0A8C9CBP3_BCL2L11      --------------------------------------------------
A0A8C9CBP3_BCL2L11      tgcccccaaggcagcccacagggcccactggccccaccggccagtcccgg
                                                                          

A0A8C9CBP3_BCL2L11      ccctttcgctaccagatccccgcttttcatcttcgtgagaagatcttccc
A0A8C9CBP3_BCL2L11      ccctttcgctaccagatccccgcttttcatcttcgtgagaagatcttccc
A0A8C9CBP3_BCL2L11      --------------------------------------------------
A0A8C9CBP3_BCL2L11      ccctttcgctaccagatccccgcttttcatcttcgtgagaagatcttccc
                                                                          

A0A8C9CBP3_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A8C9CBP3_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A8C9CBP3_BCL2L11      ----------------------------------------agacaggagc
A0A8C9CBP3_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
                                                                **********

A0A8C9CBP3_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A8C9CBP3_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A8C9CBP3_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A8C9CBP3_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
                        **************************************************

A0A8C9CBP3_BCL2L11      ccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
A0A8C9CBP3_BCL2L11      ccaggccttcaaccattatctcagtgcgat--------------------
A0A8C9CBP3_BCL2L11      ccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
A0A8C9CBP3_BCL2L11      ccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
                        ******************************                    

A0A8C9CBP3_BCL2L11      aggctgtacctgcagatatgcgtccggagatatggattgcgcaagagttg
A0A8C9CBP3_BCL2L11      --------------------------------------------------
A0A8C9CBP3_BCL2L11      aggctgtacctgcagatatgcgtccggagatatggattgcgcaagagttg
A0A8C9CBP3_BCL2L11      aggctgtacctgcagatatgcgtccggagatatggattgcgcaagagttg
                                                                          

A0A8C9CBP3_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaaggagg-----tta
A0A8C9CBP3_BCL2L11      ----------------------------------------gggtctttct
A0A8C9CBP3_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaaggagggtctttct
A0A8C9CBP3_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaaggagggtctttct
                                                                **     *  

A0A8C9CBP3_BCL2L11      gagcaatag-----------------------------------------
A0A8C9CBP3_BCL2L11      gaataa--------------------------------------------
A0A8C9CBP3_BCL2L11      gaataatcaccaagcagccgaaggtcacccgcaaatggttatcttacggc
A0A8C9CBP3_BCL2L11      gaataatcaccaagcagccgaaggtcacccgcaaatggttatcttacggc
                        **  **                                            

A0A8C9CBP3_BCL2L11      -----------------------------------------
A0A8C9CBP3_BCL2L11      -----------------------------------------
A0A8C9CBP3_BCL2L11      tcttacgccacatcatccgtctggtgtggaggatgcagtga
A0A8C9CBP3_BCL2L11      tcttacgccacatcatccgtctggtgtggaggatgcagtga
                                                                 

© 1998-2022Legal notice