Dataset for CDS BAD of organism Peromyscus maniculatus bairdii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6I9LQL5_BAD-01      atgggaaccccaaagcagcccttgctggctcctgcacatgccctaggcgt
A0A6I9LQL5_BAD-02      atgggaaccccaaagcagcccttgctggctcctgcacatgccctaggcgt
                       **************************************************

A0A6I9LQL5_BAD-01      gaggaagtcggatcccggaatccggagcctggggagcgacgcaggaggaa
A0A6I9LQL5_BAD-02      gaggaagtcggatcccggaatccggagcctggggagcgacgcaggaggaa
                       **************************************************

A0A6I9LQL5_BAD-01      ggcggtggagaccagcagcccagagtatgttccagatcccagagtttgag
A0A6I9LQL5_BAD-02      ggcggtggagaccagcagcccagagtatgttccagatcccagagtttgag
                       **************************************************

A0A6I9LQL5_BAD-01      ccgagtgagcaggaagactccagtactgctgataggggcctgggcccaag
A0A6I9LQL5_BAD-02      ccgagtgagcaggaagactccagtactgctgataggggcctgggcccaag
                       **************************************************

A0A6I9LQL5_BAD-01      cttcactggggaccaacggggtccctacctggccccaggtctcctgggga
A0A6I9LQL5_BAD-02      cttcactggggaccaacggggtccctacctggccccaggtctcctgggga
                       **************************************************

A0A6I9LQL5_BAD-01      acatcggacaccaacaggggcaggcagccaacagcagtcatcatggaggc
A0A6I9LQL5_BAD-02      acatcggacaccaacaggggcaggcagccaacagcagtcatcatggaggc
                       **************************************************

A0A6I9LQL5_BAD-01      gttggggctatggagacccggagtcgccacagttcgtaccccgcggggac
A0A6I9LQL5_BAD-02      gttggggctatggagacccggagtcgccacagttcgtaccccgcggggac
                       **************************************************

A0A6I9LQL5_BAD-01      cgaggaggatgaagggacggaggaggagctcagcccctttcggggccgct
A0A6I9LQL5_BAD-02      cgaggaggatgaagggacggaggaggagctcagcccctttcggggccgct
                       **************************************************

A0A6I9LQL5_BAD-01      cgcgttcggctccccccaacctctgggccgcgcagcgttacggccgcgag
A0A6I9LQL5_BAD-02      cgcgttcggctccccccaacctctgggccgcgcagcgttacggccgcgag
                       **************************************************

A0A6I9LQL5_BAD-01      ctccgaaggatgagcgacgagtttgagggttccttcaaggga--------
A0A6I9LQL5_BAD-02      ctccgaaggatgagcgacgagtttgagggttccttcaagggacttcctcg
                       ******************************************        

A0A6I9LQL5_BAD-01      ---gaagagc---------------------tggccaa----cagcttga
A0A6I9LQL5_BAD-02      cccaaagagcgcggggactgcaacacagatgcgacaaagcgccagctgga
                           ******                      * * **    ***** **

A0A6I9LQL5_BAD-01      gtccc---------ttctggtg-----------cgtgcaatag-------
A0A6I9LQL5_BAD-02      cgcgcattatccagtcctggtgggatcgaaacttgggcaaaggaggctcc
                         * *         * ******            * ****  *       

A0A6I9LQL5_BAD-01      ---------------
A0A6I9LQL5_BAD-02      accccctcccagtga
                                      

© 1998-2022Legal notice