Dataset for CDS BMF of organism Pavo cristatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9F3R5_BMF-01      caccgttcacctaagaacaccccaaccccacgctcagagaggccgaagag
A0A8C9F3R5_BMF-02      -----------atggatcgccccagctacctg------------------
                                     ** * ***** *  *  *                  

A0A8C9F3R5_BMF-01      caggagaggaacggcagcacttctagcagcgccgggcccggccgcgcccc
A0A8C9F3R5_BMF-02      --gaagagga-------ctattctggcctggatgggctggac--------
                         * ******       *  **** **   *  ****  * *        

A0A8C9F3R5_BMF-01      cggaggccggttctccatcggctcgactctcccgcccctctcctcaaccg
A0A8C9F3R5_BMF-02      --gatgacgtgtttc----------actctgatgactttggacttg----
                         ** * **  * **          *****   * *  *   **      

A0A8C9F3R5_BMF-01      ttcccgggccgccctctcgcg-----cgcggcggccgttgccgc------
A0A8C9F3R5_BMF-02      ----caggtcagcctggtgagatgactgcaactggcattttcacacagaa
                           * ** *  ***   * *      **  * * * **  * *      

A0A8C9F3R5_BMF-01      tcggcccccccgctgctcattggctgtcgggcgggggcggggcccgcgcg
A0A8C9F3R5_BMF-02      ccagtcctacagctgccttctgg---------------------------
                        * * **  * *****    ***                           

A0A8C9F3R5_BMF-01      gcgggggtggggctgccgtcagctg-ttcgccgtgcgctcggcggcggcg
A0A8C9F3R5_BMF-02      --ggaggt---------ttcaactatttcccctcacacactgctgtggt-
                         ** ***          *** **  *** **   * * * ** * **  

A0A8C9F3R5_BMF-01      gcagtttggcggtggggaggcgcagtgacggttcccgctctaggggcgcc
A0A8C9F3R5_BMF-02      ----cccggtgtcaggcatcctgagcagcaggac--------aaggcaac
                              ** *   ** *  *  **   * *  *          ***  *

A0A8C9F3R5_BMF-01      cccgtccctgtgggacgcccggcccggcccggcccggcccggc-------
A0A8C9F3R5_BMF-02      tc----------aaacactcagcccatcctcttccagtcaggatgttatg
                        *            ** * * ****  **    ** * * **        

A0A8C9F3R5_BMF-01      ccgctcggcggag-caatggatcgccccagctacctggaagaggactatt
A0A8C9F3R5_BMF-02      ttgccttgtggagtcactgaagagcccc------------ggagactctt
                         **   * **** ** ** *  *****            *  **** **

A0A8C9F3R5_BMF-01      ctggcctggatgggctggacgatgacgtgtttcactctgatgactttgga
A0A8C9F3R5_BMF-02      ctat----------------------------------------------
                       **                                                

A0A8C9F3R5_BMF-01      cttgcagggaatgctggttaccgcttacacgtccctccagttggctttgc
A0A8C9F3R5_BMF-02      ------gggaatgctggttaccgcttacacgtccctccagttggctttgc
                             ********************************************

A0A8C9F3R5_BMF-01      attggatccaaatctccaagaagagcctcaggaaggtcagcaggaggcgc
A0A8C9F3R5_BMF-02      attggatccaaatctccaagaagagcctcaggaaggtcagcaggaggcgc
                       **************************************************

A0A8C9F3R5_BMF-01      gtactgaggtgcagattgcgcggaagttgcagtgcattgcagaccagttc
A0A8C9F3R5_BMF-02      gtactgaggtgcagattgcgcggaagttgcagtgcattgcagaccagttc
                       **************************************************

A0A8C9F3R5_BMF-01      caccggctccacatacagcggcatcagcagaacagaaatcaagtgtggtg
A0A8C9F3R5_BMF-02      caccggctccacatacagcgg---------------------gtagggtg
                       *********************                     **  ****

A0A8C9F3R5_BMF-01      gcagctttttctctttctacacaacttggccttaaacg--tggaggcgaa
A0A8C9F3R5_BMF-02      -------------cttccaga------ggntgcaaattacagaaaacgat
                                     *** * *      **    ***     * *  *** 

A0A8C9F3R5_BMF-01      caggaaccgca--ctgggcagaggtga
A0A8C9F3R5_BMF-02      gaacaaccacaagctttttag------
                        *  **** **  **    **      

© 1998-2022Legal notice