Dataset for CDS classical BH3-containing proteins of organism Paramormyrops kingsleyae

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B3QC78_BCL2L11      atggg-------------------acaaattctat------taacgatcc
A0A3B3QX41_BAD-01       atgtcgggtgtcaccatggcgcacatgtttaccatctccggcaatgagtc
A0A3B3RH63_BMF-01       atggacgatg--acgatgacg---atgtgttcca-------cacggaccc
                        ***                     *    * * *        *  **  *

A0A3B3QC78_BCL2L11      cctgctctgtctgttc---tgcagagg-acaaaatcacacgaatgg----
A0A3B3QX41_BAD-01       ggacacttctgaatcc-------gacacaccagatgtcaca---------
A0A3B3RH63_BMF-01       gctcacctatcagcccccgttcagggatataaagtgtgagaatcggggca
                               * *     *       *    *  *  *   *           

A0A3B3QC78_BCL2L11      cggagagtcgcaacccagtggcg--gaacagactccgatccaagcc----
A0A3B3QX41_BAD-01       -gcaaattcacagcttgg-------aaataacctcaaaa-----------
A0A3B3RH63_BMF-01       cgcagacgcccggcccagccctggtgcagggcctcaacatgctgccctgt
                         * * *  * *  *   *         *    ***               

A0A3B3QC78_BCL2L11      -----ggtccgagaaccgccaaggtccctggtcaactgcaagcgaccccg
A0A3B3QX41_BAD-01       -----atacgaaaaatccaggagaggct--ggaggtcgtgtacg--gatg
A0A3B3RH63_BMF-01       ggcgtgggccaagagccacgcagactcttctacggtagtgcagg--cttg
                                *  * *  *    **   *          *     *     *

A0A3B3QC78_BCL2L11      cgatttagtacgctgtccgcatcg---tcaagcggatatcattcactcga
A0A3B3QX41_BAD-01       cggtccgaatcccaggtttcttcgattcgaagcgaggatc----------
A0A3B3RH63_BMF-01       cggctgcatttcccggcactttcggtgcccggcgggcacc----------
                        **          * *      ***       ***   * *          

A0A3B3QC78_BCL2L11      catttcccttccaaactctccctttatgactcataacaagtcgacacaga
A0A3B3QX41_BAD-01       ----------tcgattttggtgaaggaggtgcatctgaggagggcggagg
A0A3B3RH63_BMF-01       -----------------cgccgcaggaggagc----------ggcag---
                                                   *   *          * *     

A0A3B3QC78_BCL2L11      cccccagtccgtctaatcatcttgtttgcatttatttgagctcagtaacg
A0A3B3QX41_BAD-01       cgtgtgccccggggatggcactccttttcg----------------agga
A0A3B3RH63_BMF-01       -------cccgacgac----------------------------------
                                ***   *                                   

A0A3B3QC78_BCL2L11      cggacgctgtcgatgctgccggacatgcggccagagatgctggtcgcacg
A0A3B3QX41_BAD-01       cgctcgcggtcagccccgcccgcgctgtgggcagcacagcggtatggacg
A0A3B3RH63_BMF-01       cgcccgcaaccga--------gcgccgaggtc-------cggattggcca
                        **  ***   *          *    * ** *       * *   *  * 

A0A3B3QC78_BCL2L11      agagctgcggcgcatcggtgacaagttcaatga-----------------
A0A3B3QX41_BAD-01       acagctgcggcgtatgagtgacgagtttgac---------accctgctgg
A0A3B3RH63_BMF-01       gaagcttcagatgattggagaccagtttcaccaagaccaactccagttgt
                          **** * *   **  * *** ****  *                    

A0A3B3QC78_BCL2L11      --tatctacataaatggggtgagtatcctactctgtcctcactgtcctct
A0A3B3QX41_BAD-01       a-caaagggatgaagagggtgcgca----g------------tgccgggg
A0A3B3RH63_BMF-01       accacagaaaccaaaggaatcagcagccgg------------tgtggtgg
                           *     *  **  *  *  * *                 **      

A0A3B3QC78_BCL2L11      tcggccaactgctatgggc--caaggggcaacactgactccttaccctgg
A0A3B3QX41_BAD-01       ctgcccgacagatgcaggcgtcccccagctggttcgcct--ttctctgga
A0A3B3RH63_BMF-01       cggcttg-----tgatggc--------gctgtgtggcctcctcttcgaga
                          *         *   ***        **      * **  *   *  * 

A0A3B3QC78_BCL2L11      gg-acaacaagaacaaagagtcacccctaagatccagatcttcctggctc
A0A3B3QX41_BAD-01       gccacaaggagagcgacg----------------cgg-------------
A0A3B3RH63_BMF-01       ggcgcca-aagagcagag----------------cag-------------
                        *   * *  *** *   *                * *             

A0A3B3QC78_BCL2L11      catgttagaatgggggaagtggagcaacaggaaatagta-----------
A0A3B3QX41_BAD-01       ------agatcagcggaagcttgtcgaccgccgacagcagagctgcacag
A0A3B3RH63_BMF-01       ------aga-----------------------------------------

A0A3B3QC78_BCL2L11      tga
A0A3B3QX41_BAD-01       tga
A0A3B3RH63_BMF-01       tga

© 1998-2020Legal notice