Dataset for CDS BMF of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A096NTE9_BMF-01      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
A0A096NTE9_BMF-02      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
                       **************************************************

A0A096NTE9_BMF-01      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc
A0A096NTE9_BMF-02      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc
                       **************************************************

A0A096NTE9_BMF-01      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
A0A096NTE9_BMF-02      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
                       **************************************************

A0A096NTE9_BMF-01      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A096NTE9_BMF-02      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
                       **************************************************

A0A096NTE9_BMF-01      caaggccacccagaccctcggcccagcctcccccagccaaggtgtcatgc
A0A096NTE9_BMF-02      caaggccacccagaccctcggcccagcctcccccagccaaggtgtcatgc
                       **************************************************

A0A096NTE9_BMF-01      tgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgct
A0A096NTE9_BMF-02      tgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgct
                       **************************************************

A0A096NTE9_BMF-01      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
A0A096NTE9_BMF-02      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
                       **************************************************

A0A096NTE9_BMF-01      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
A0A096NTE9_BMF-02      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
                       **************************************************

A0A096NTE9_BMF-01      cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcag
A0A096NTE9_BMF-02      cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcag
                       **************************************************

A0A096NTE9_BMF-01      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctc--ctcttc
A0A096NTE9_BMF-02      caaacctcaaaga------------tatggtcccagagttttggttcttg
                       ***  *    ***            * ****  ****   *    **** 

A0A096NTE9_BMF-01      ctgcacaaccttgctttgaatggagaagagaacaggaacggggcgga---
A0A096NTE9_BMF-02      cgg-------ttgcc----atgggcaggatgggcccaactggatgagcat
                       * *       ****     ****  * **       *** **  *     

A0A096NTE9_BMF-01      -----------ccctaggcccctgacctggaatggggccgttgtcaaacc
A0A096NTE9_BMF-02      cttgccctcatctctgagctccacattggtaaactgcccgctctcaactc
                                  * **  ** **  *   * **   * *** * ****  *

A0A096NTE9_BMF-01      ctgt----tga
A0A096NTE9_BMF-02      atgttccataa
                        ***    * *

© 1998-2022Legal notice