Dataset for CDS BCL2L11 of organism Panthera tigris altaica

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C9JC73_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C9JC73_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C9JC73_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C9JC73_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C9JC73_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C9JC73_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg

A0A8C9JC73_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
A0A8C9JC73_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
A0A8C9JC73_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
A0A8C9JC73_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
A0A8C9JC73_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
A0A8C9JC73_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta

A0A8C9JC73_BCL2L11      cctctctacagacagagcagcaag--------------------------
A0A8C9JC73_BCL2L11      cctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgc
A0A8C9JC73_BCL2L11      cctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgc
A0A8C9JC73_BCL2L11      cctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgc
A0A8C9JC73_BCL2L11      cctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgc
A0A8C9JC73_BCL2L11      cctctctacagacagagcagca----------------------------

A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      tgcccccaaggcagccctcagggcccgctggccccaccagccagccccgg
A0A8C9JC73_BCL2L11      tgcccccaaggcagccctcagggcccgctggccccaccagccagccccgg
A0A8C9JC73_BCL2L11      tgcccccaaggcagccctcagggcccgctggccccaccagccagccccgg
A0A8C9JC73_BCL2L11      tgcccccaaggcagccctcagggcccgctggccccaccagccagccccgg
A0A8C9JC73_BCL2L11      --------------------------------------------------

A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      gccttttgctaccagatccccgcttttcatctttgtcagaagatcctccc
A0A8C9JC73_BCL2L11      gccttttgctaccagatccccgcttttcatctttgtcagaagatcctccc
A0A8C9JC73_BCL2L11      gccttttgctaccagatccccgcttttcatctttgtcagaagatcctccc
A0A8C9JC73_BCL2L11      gccttttgctaccagatccccgcttttcatctttgtcagaagatcctccc
A0A8C9JC73_BCL2L11      --------------------------------------------------

A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A8C9JC73_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A8C9JC73_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A8C9JC73_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A8C9JC73_BCL2L11      ----------------------------------------agacaggagc

A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A8C9JC73_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A8C9JC73_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A8C9JC73_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A8C9JC73_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg

A0A8C9JC73_BCL2L11      --------------------------------cttccatgaggcagcctc
A0A8C9JC73_BCL2L11      ccaggccttcaaccattatctcagtgcaatggtt----------------
A0A8C9JC73_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
A0A8C9JC73_BCL2L11      ccaggccttcaaccattatctcagtgcaat--------------------
A0A8C9JC73_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
A0A8C9JC73_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc

A0A8C9JC73_BCL2L11      aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttg
A0A8C9JC73_BCL2L11      -------------------------agagcaatag---------------
A0A8C9JC73_BCL2L11      aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttg
A0A8C9JC73_BCL2L11      --------------------------------------------------
A0A8C9JC73_BCL2L11      aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttg
A0A8C9JC73_BCL2L11      aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttg

A0A8C9JC73_BCL2L11      cggcgtatcggagacgaatttaatgcatattacccaaggagg-----ctg
A0A8C9JC73_BCL2L11      ------------------------------------aggaaggtgtcctg
A0A8C9JC73_BCL2L11      cggcgtatcggagacgaatttaatgcatattacccaaggagg-----tta
A0A8C9JC73_BCL2L11      ----------------------------------------gggtcttttt
A0A8C9JC73_BCL2L11      cggcgtatcggagacgaatttaatgcatattacccaaggagggtcttttt
A0A8C9JC73_BCL2L11      cggcgtatcggagacgaatttaatgcatattacccaaggagggtcttttt
                                                                 *      * 

A0A8C9JC73_BCL2L11      gcaagagtaccggcatcctacatctga-----------------------
A0A8C9JC73_BCL2L11      tag-----------------------------------------------
A0A8C9JC73_BCL2L11      gagcaatag-----------------------------------------
A0A8C9JC73_BCL2L11      gaataa--------------------------------------------
A0A8C9JC73_BCL2L11      gaataattaccaagcagccgaagcccagccccaaatgattatcttacgac
A0A8C9JC73_BCL2L11      gaataattaccaagcagccgaagcccagccccaaatgattatcttacgac

A0A8C9JC73_BCL2L11      -----------------------------------------
A0A8C9JC73_BCL2L11      -----------------------------------------
A0A8C9JC73_BCL2L11      -----------------------------------------
A0A8C9JC73_BCL2L11      -----------------------------------------
A0A8C9JC73_BCL2L11      tgttacgttacatcgtccgcctgatatggcgattgcagcga
A0A8C9JC73_BCL2L11      tgttacgttacatcgtccgcctgatatggcgattgcagcga

© 1998-2022Legal notice