Dataset for CDS BCL2L11 of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I3SN61_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3SN61_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag

A0A2I3SN61_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3SN61_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta

A0A2I3SN61_BCL2L11      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3SN61_BCL2L11      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt

A0A2I3SN61_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3SN61_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc

A0A2I3SN61_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3SN61_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga

A0A2I3SN61_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3SN61_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac

A0A2I3SN61_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3SN61_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc

A0A2I3SN61_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I3SN61_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggct----

A0A2I3SN61_BCL2L11      tgaggcaggctgaacctgcagatatgcgaccggagatatggatcgcccaa
A0A2I3SN61_BCL2L11      -------------aactg--------------------------------
                                     * ***                                

A0A2I3SN61_BCL2L11      gagttgcggcgtatcggagacgagtttaacgcttactatgcaaggaggtt
A0A2I3SN61_BCL2L11      --------------------------------------------------

A0A2I3SN61_BCL2L11      agagaaatag
A0A2I3SN61_BCL2L11      ---ggactag
                           * * ***

© 1998-2020Legal notice