Dataset for CDS BBC3 of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3RGH5_BBC3-05      atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccag
A0A2I3RGH5_BBC3-03      atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccag
A0A2I3RGH5_BBC3-04      atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccag
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccag
                                                                          

A0A2I3RGH5_BBC3-05      ggctgcttccgcgacgtgggtcccctgccagatttgtg------------
A0A2I3RGH5_BBC3-03      ggctgcttccgcgacgtgggtcccctgccagatttgtg------------
A0A2I3RGH5_BBC3-04      ggctgcttccgcgacgtgggtcccctgccagatttgtggccccagggagc
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      ggctgcttccgcgacgtgggtcccctgccagatttgtggccccagggagc
                                                                          

A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      gccatggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
A0A2I3RGH5_BBC3-01      ---atggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
A0A2I3RGH5_BBC3-02      gccatggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
                                                                          

A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      cctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccct
A0A2I3RGH5_BBC3-01      cctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccct
A0A2I3RGH5_BBC3-02      cctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccct
                                                                          

A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      cggcagtgtcctgcggcctctgcgagcccggcctggctgccgcccccgcc
A0A2I3RGH5_BBC3-01      cggcagtgtcctgcggcctctgcgagcccggcctggctgccgcccccgcc
A0A2I3RGH5_BBC3-02      cggcagtgtcctgcggcctctgcgagcccggcctggctgccgcccccgcc
                                                                          

A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      gcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacc
A0A2I3RGH5_BBC3-01      gcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacc
A0A2I3RGH5_BBC3-02      gcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacc
                                                                          

A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      cgccgtcaccgccgccctggggggtccccgctggcctgggggtccccgca
A0A2I3RGH5_BBC3-01      cgccgtcaccgccgccctggggggtccccgctggcctgggggtccccgca
A0A2I3RGH5_BBC3-02      cgccgtcaccgccgccctggggggtccccgctggcctgggggtccccgca
                                                                          

A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      gccggccccgaggcccgcgcccggacgggctggagactcggaggaactgg
A0A2I3RGH5_BBC3-01      gccggccccgaggcccgcgcccggacg-----------------------
A0A2I3RGH5_BBC3-02      gccggccccgaggcccgcgcccggacg-----------------------
                                                                          

A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      ----gtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
A0A2I3RGH5_BBC3-04      agaagtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
A0A2I3RGH5_BBC3-01      ----gtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
A0A2I3RGH5_BBC3-02      ----gtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
                                                                          

A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      cgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccc
A0A2I3RGH5_BBC3-04      cgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccc
A0A2I3RGH5_BBC3-01      cgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccc
A0A2I3RGH5_BBC3-02      cgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccc
                                                                          

A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      cgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccag
A0A2I3RGH5_BBC3-04      cgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccag
A0A2I3RGH5_BBC3-01      cgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccag
A0A2I3RGH5_BBC3-02      cgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccag
                                                                          

A0A2I3RGH5_BBC3-05      ---------------------------------------------agaca
A0A2I3RGH5_BBC3-03      ctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagaca
A0A2I3RGH5_BBC3-04      ctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagaca
A0A2I3RGH5_BBC3-01      ctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagaca
A0A2I3RGH5_BBC3-02      ctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagaca
                                                                     *****

A0A2I3RGH5_BBC3-05      agaggagcagcagcggcaccgcccctcgccctggagggtcctgtacaatc
A0A2I3RGH5_BBC3-03      agaggagcagcagcggcaccgcccctcgccctggagggtcctgtacaatc
A0A2I3RGH5_BBC3-04      agaggagcagcagcggcaccgcccctcgccctggagggtcctgtacaatc
A0A2I3RGH5_BBC3-01      agaggagcagcagcggcaccgcccctcgccctggagggtcctgtacaatc
A0A2I3RGH5_BBC3-02      agaggagcagcagcggcaccgcccctcgccctggagggtcctgtacaatc
                        **************************************************

A0A2I3RGH5_BBC3-05      tcatcatgggactcctgcccttacccaggggccacagagcccccgagatg
A0A2I3RGH5_BBC3-03      tcatcatgggactcctgcccttacccaggggccacagagcccccgagatg
A0A2I3RGH5_BBC3-04      tcatcatgggactcctgcccttacccaggggccacagagcccccgagatg
A0A2I3RGH5_BBC3-01      tcatcatgggactcctgcccttacccaggggccacagagcccccgagatg
A0A2I3RGH5_BBC3-02      tcatcatgggactcctgcccttacccaggggccacagagcccccgagatg
                        **************************************************

A0A2I3RGH5_BBC3-05      gagcccaattaggtgcctgcacccgcccggtggacgtcagggactcgggg
A0A2I3RGH5_BBC3-03      gagcccaattag--------------------------------------
A0A2I3RGH5_BBC3-04      gagcccaattaggtgcctgcacccgcccggtggacgtcagggactcgggg
A0A2I3RGH5_BBC3-01      gagcccaattag--------------------------------------
A0A2I3RGH5_BBC3-02      gagcccaattaggtgcctgcacccgcccggtggacgtcagggactcgggg
                        ************                                      

A0A2I3RGH5_BBC3-05      ggcaggcccctcccacctcctgacaccctggccagcgcgggggactttct
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      ggcaggcccctcccacctcctgacaccctggccagcgcgggggactttct
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      ggcaggcccctcccacctcctgacaccctggccagcgcgggggactttct
                                                                          

A0A2I3RGH5_BBC3-05      ctgcaccatgtag
A0A2I3RGH5_BBC3-03      -------------
A0A2I3RGH5_BBC3-04      ctgcaccatgtag
A0A2I3RGH5_BBC3-01      -------------
A0A2I3RGH5_BBC3-02      ctgcaccatgtag
                                     

© 1998-2020Legal notice