Dataset for CDS BAD of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3TBK7_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2I3TBK7_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
                       **************************************************

A0A2I3TBK7_BAD-03      tgcagagaggggcctgggccccagccccgcaggggacgggccctcaggct
A0A2I3TBK7_BAD-01      tgcagagaggggcctgggccccagccccgcaggggacgggccctcaggct
                       **************************************************

A0A2I3TBK7_BAD-03      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2I3TBK7_BAD-01      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
                       **************************************************

A0A2I3TBK7_BAD-03      cagcaggagcagccaaccagcagcagccatcatggagggagaacttcgta
A0A2I3TBK7_BAD-01      cagcaggagcagccaaccagcagcagccatcatggagaagggacttc---
                       *************************************   * *****   

A0A2I3TBK7_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcagggatgc
A0A2I3TBK7_BAD-01      --ctc----------gcccgaagagcgcgggcacagcaacccaga-----
                         ***            * ** **    *   *   **   ***      

A0A2I3TBK7_BAD-03      ttgcgg--aagcatcagcagggatgtccgcc--ccagcc---gctgactc
A0A2I3TBK7_BAD-01      -tgcggcaaagctccagc-tggacgcgagtcttccagtcctggtgggatc
                        *****  ****  ****  *** *   * *  **** *   *  *  **

A0A2I3TBK7_BAD-03      agaagcccaacacgcagagaatgtaaagct------------agaggcgc
A0A2I3TBK7_BAD-01      ggaactt---------gggcaggggaagctccgccccctcccagtgacct
                        ***            * * * *  *****            ** * *  

A0A2I3TBK7_BAD-03      tggggctgtggagatccggagtcgcca-cagctcctaccccgcggggacg
A0A2I3TBK7_BAD-01      tcgctcc----acatcccgaaactccacccgttcccactgccctggg---
                       * *  *     * **** **  * *** * * *** **  * * ***   

A0A2I3TBK7_BAD-03      gaggacgacga--agggatgggggaggagcccagcccctttcggggccgc
A0A2I3TBK7_BAD-01      -----cagccatcttgaatatgggcggaagt--acttccctcaggcctat
                            *  * *    * **  *** ***      *  *  ** ** *   

A0A2I3TBK7_BAD-03      tcgc------gctcggcgccccccaacctctgggcagcacagcgctatgg
A0A2I3TBK7_BAD-01      gcaaaaagaggatccgtgctgtct--cctttggaggg---agggc--tga
                        *        * ** * **   *   *** ***   *   ** **  ** 

A0A2I3TBK7_BAD-03      ccgcgagctcc------ggaggatga
A0A2I3TBK7_BAD-01      ccccgattcccttccggtgcgtgtga
                       ** ***   **       * *  ***

© 1998-2020Legal notice