Dataset for CDS BAD of organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2R8Z674_BAD-02      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2R8Z674_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2R8Z674_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc

A0A2R8Z674_BAD-02      tgcagagaggggcctgggccccagccccgcaggggacgggccctcgggct
A0A2R8Z674_BAD-01      tgcagagaggggcctgggccccagccccgcaggggacgggccctcgggct
A0A2R8Z674_BAD-03      tgcagagaggggcctgggccccagccccgcaggggacgggccctcgggct

A0A2R8Z674_BAD-02      ccagcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2R8Z674_BAD-01      ccagcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2R8Z674_BAD-03      ccagcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac

A0A2R8Z674_BAD-02      cagcaggagcagccaaccagcagcagccatcatggagaagggacttcct-
A0A2R8Z674_BAD-01      cagcaggagcagccaaccagcagcagccatcatg----------------
A0A2R8Z674_BAD-03      cagcaggagcagccaaccagcagcagccatcatggagggagaacttcgta

A0A2R8Z674_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcagggatgc

A0A2R8Z674_BAD-02      --------------------------------------------------
A0A2R8Z674_BAD-01      --------------------------------------------------
A0A2R8Z674_BAD-03      tcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcc

A0A2R8Z674_BAD-02      ---cgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccag
A0A2R8Z674_BAD-01      ------------------------gaggcgctggggctgtggagatccgg
A0A2R8Z674_BAD-03      caacacgcagagaatgtaaagctagaggcgctggggctgtggagatccgg
                                               *   *** *  ** *   ** *** *

A0A2R8Z674_BAD-02      ctggacgcgagtcttccagtcctggtgggatcg--------gaacttggg
A0A2R8Z674_BAD-01      --agtcgccacagctcctaccccgcggggacggaggacgacgaagggatg
A0A2R8Z674_BAD-03      --agtcgccacagctcctaccccgcggggacggaggacgacgaagggatg
                          * *** *    ***   ** *  ****  *        ***     *

A0A2R8Z674_BAD-02      caggggaagctccgccccctcc-cagtgactttcgctccacatcccgaaa
A0A2R8Z674_BAD-01      ggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaa
A0A2R8Z674_BAD-03      ggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaa
                         ** * *** * ***** * *   *   **  *****  *  ***  **

A0A2R8Z674_BAD-02      ctccacccgttcccactgccctgggcagc-catcttgaatatgggcggaa
A0A2R8Z674_BAD-01      c-----------------ctctgggcagcacagc---gctatggccgcga
A0A2R8Z674_BAD-03      c-----------------ctctgggcagcacagc---gctatggccgcga
                       *                 * ********* ** *     ***** **  *

A0A2R8Z674_BAD-02      gtacttccctcaggcctatgcaaaaagaggatccgtgct-----------
A0A2R8Z674_BAD-01      g-------ctccggaggatgagtgacgagtttgtggactcctttaagaag
A0A2R8Z674_BAD-03      g-------ctccggaggatga-----------------------------
                       *       *** **   ***                              

A0A2R8Z674_BAD-02      -gtctcctttggagggagggc----------tgacccagattc-------
A0A2R8Z674_BAD-01      ggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaag
A0A2R8Z674_BAD-03      --------------------------------------------------

A0A2R8Z674_BAD-02      -----------------ccttccggtgcgtgtga----------------
A0A2R8Z674_BAD-01      ctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggca
A0A2R8Z674_BAD-03      --------------------------------------------------

A0A2R8Z674_BAD-02      --------------------------
A0A2R8Z674_BAD-01      ggggaagctccgccccctcccagtga
A0A2R8Z674_BAD-03      --------------------------

© 1998-2022Legal notice