Dataset for CDS BAD of organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2R8Z688_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2R8Z688_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
                       **************************************************

A0A2R8Z688_BAD-01      tgcagagaggggcctgggccccagccccgcaggggacgggccctcgggct
A0A2R8Z688_BAD-03      tgcagagaggggcctgggccccagccccgcaggggacgggccctcgggct
                       **************************************************

A0A2R8Z688_BAD-01      ccagcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2R8Z688_BAD-03      ccagcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
                       **************************************************

A0A2R8Z688_BAD-01      cagcaggagcagccaaccagcagcagccatcatg----------------
A0A2R8Z688_BAD-03      cagcaggagcagccaaccagcagcagccatcatggagggagaacttcgta
                       **********************************                

A0A2R8Z688_BAD-01      --------------------------------------------------
A0A2R8Z688_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcagggatgc
                                                                         

A0A2R8Z688_BAD-01      --------------------------------------------------
A0A2R8Z688_BAD-03      tcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcc
                                                                         

A0A2R8Z688_BAD-01      ------------------------gaggcgctggggctgtggagatccgg
A0A2R8Z688_BAD-03      caacacgcagagaatgtaaagctagaggcgctggggctgtggagatccgg
                                               **************************

A0A2R8Z688_BAD-01      agtcgccacagctcctaccccgcggggacggaggacgacgaagggatggg
A0A2R8Z688_BAD-03      agtcgccacagctcctaccccgcggggacggaggacgacgaagggatggg
                       **************************************************

A0A2R8Z688_BAD-01      ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacc
A0A2R8Z688_BAD-03      ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacc
                       **************************************************

A0A2R8Z688_BAD-01      tctgggcagcacagcgctatggccgcgagctccggaggatgagtgacgag
A0A2R8Z688_BAD-03      tctgggcagcacagcgctatggccgcgagctccggaggatga--------
                       ******************************************        

A0A2R8Z688_BAD-01      tttgtggactcctttaagaagggacttcctcgcccgaagagcgcgggcac
A0A2R8Z688_BAD-03      --------------------------------------------------
                                                                         

A0A2R8Z688_BAD-01      agcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcct
A0A2R8Z688_BAD-03      --------------------------------------------------
                                                                         

A0A2R8Z688_BAD-01      ggtgggatcggaacttgggcaggggaagctccgccccctcccagtga
A0A2R8Z688_BAD-03      -----------------------------------------------
                                                                      

© 1998-2020Legal notice