Dataset for CDS classical BH3-containing proteins of organism Otus sunia

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C8AGU8_BCL2L11      --------------------------------------------------
A0A8C8B299_BMF-01       atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8C8B736_PMAIP1-      at------------------------------------------------
                                                                          

A0A8C8AGU8_BCL2L11      -------------ttttcctcttatga------------------gc---
A0A8C8B299_BMF-01       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C8B736_PMAIP1-      ---------------------------------------------gcctg
                                                                     **   

A0A8C8AGU8_BCL2L11      -----------------------------cagcact--------------
A0A8C8B299_BMF-01       gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A8C8B736_PMAIP1-      g----------------------------caggacc--------------
                                                     *** **               

A0A8C8AGU8_BCL2L11      --------------------------------------------------
A0A8C8B299_BMF-01       cttctggggaggtttcaactattccccctcacacactgctgtggtcccgg
A0A8C8B736_PMAIP1-      -----------------------------------ctgc-----------
                                                                          

A0A8C8AGU8_BCL2L11      --------------------------------------------------
A0A8C8B299_BMF-01       tatcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A0A8C8B736_PMAIP1-      ------------------gcaagac-------------cgcgccgcccg-
                                                                          

A0A8C8AGU8_BCL2L11      --------------------------------------------------
A0A8C8B299_BMF-01       cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8C8B736_PMAIP1-      --------------------------------------------------
                                                                          

A0A8C8AGU8_BCL2L11      --------------------------------------------------
A0A8C8B299_BMF-01       cggagactcttctatggcaatgctggttaccgtttacacgtccctccagt
A0A8C8B736_PMAIP1-      --------------------------------------------------
                                                                          

A0A8C8AGU8_BCL2L11      --------------------------------------------------
A0A8C8B299_BMF-01       tggctttgcgttggatccgcacctccaggaggagcctcgggaaggtcagc
A0A8C8B736_PMAIP1-      ----------------ccgcccccgcag-------------------agc
                                                                          

A0A8C8AGU8_BCL2L11      ----ggtttgccccgaaatctggattgcacaggagctgcggcgcatcgga
A0A8C8B299_BMF-01       gggaagcacgtgccgaggtgcagattgcacggaagttgcagtgcattgcc
A0A8C8B736_PMAIP1-      gggaggcg-gtggcggagtgc-----gccctgcagctgcgcaggataggc
                             *   *   **   *       ** * * ** ***   * ** *  

A0A8C8AGU8_BCL2L11      gatgagttcaatgcctcctat-----------------------------
A0A8C8B299_BMF-01       gaccagttccaccggctccacatacagaggcatcagcagaacagaaatca
A0A8C8B736_PMAIP1-      gacaagtgggacc-------------------------------------
                        **  ***   *                                       

A0A8C8AGU8_BCL2L11      --tgtccaagaagggtaactttcatctttttactttccatttctttacat
A0A8C8B299_BMF-01       agtgtggtggcag----ctttttctcttcctacacaacttggccttaaat
A0A8C8B736_PMAIP1-      --tgcggcagaag----atcctgaacctcct-cacaa-------------
                          **     * **        *   * *  * *                 

A0A8C8AGU8_BCL2L11      acggcctctaaaagggaaaagcttaatcatctctggaaactagttctgcg
A0A8C8B299_BMF-01       gcggaggcgaacaggaaccacactgggc------agag------------
A0A8C8B736_PMAIP1-      ---------------agctgttctgccc------ggaaac----------
                                               *   *       **             

A0A8C8AGU8_BCL2L11      gtga
A0A8C8B299_BMF-01       gtga
A0A8C8B736_PMAIP1-      gtga
                        ****

© 1998-2022Legal notice