Dataset for CDS classical BH3-containing proteins of organism Otolemur garnettii

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H0WYH6_BMF-01          atgga----------------gccatcgcagtgtgtggaggaactggagg
H0XAE7_BIK-01          atgtc------------------------------------agcaggaag
H0XW23_BCL2L11-01      atggcaaagcaaccttcagatgtaggttctgagtgtgaccgagaaggtgg
H0WVR2_BAD-01          atgtt----------ccagatcccagagtttgagccgagtgagcaggaag
H0XQ00_BBC3-01         atggc----------cc--------------gcgcacgccaagagggcag
H0Y001_HRK-01          atg-----------------------------------------------

H0WYH6_BMF-01          atgacgtgttccaaccagaggatggggagctggggactgggaatgtgctc
H0XAE7_BIK-01          gcca--------------------gtctccatggaccactttatggagac
H0XW23_BCL2L11-01      acaat----tgcaacctgcggagagacctccccagctcaggcctggggcc
H0WVR2_BAD-01          actcc----agctcctcagatag-g--------------ggcctgggccc
H0XQ00_BBC3-01         ctccc----cggagcccgtagag-ggcctggctcgcgacggtccgcgccc
H0Y001_HRK-01          ---------------------------------------tgcccgtgccc
                                                                   *    *

H0WYH6_BMF-01          tctgctgacctgtttgcccagagccagctggactgtccccttagccggct
H0XAE7_BIK-01          cttcccatttgagc-----agctc---ctggagcctctgacaatggaggt
H0XW23_BCL2L11-01      cctacctctctacatacagagccc---caaggtaatcccgaaggcaatcc
H0WVR2_BAD-01          cagcccctcaggggacc--agccc---ctaggccccggcaaga-------
H0XQ00_BBC3-01         cttcccgctcggccgcctagtgcc---ctcggccgtgtcctgcggcctct
H0Y001_HRK-01          cctgcaccgcggccgc---ggccc---cccggccgtgt------------
                           *                  *   *  *                   

H0WYH6_BMF-01          tcagctcttccctctcacccactgct---gtg--gccctgggct------
H0XAE7_BIK-01          tcttggcatgactgagcccaacccca--tggagtgcctggaggacagtga
H0XW23_BCL2L11-01      ggaagtcgaaggggaccgctgcccccaaggcagccctcagggcccactgg
H0WVR2_BAD-01          --------------------accgct---gcacgactccaagtctcctg-
H0XQ00_BBC3-01         gcgagcccggcctgcccgccgcccct---gcc--gccccggctctgctg-
H0Y001_HRK-01          --------------------gcgcct---gca--gc------------g-
                                            *  *    *     *              

H0WYH6_BMF-01          -ccgaccaaccagccaggaagacaaagccactcagaccc-----------
H0XAE7_BIK-01          ccaggtggc-----------------------------------------
H0XW23_BCL2L11-01      ccccaccggccagccctggtccttttgctaccagatccccgcttttcatc
H0WVR2_BAD-01          -ggggacgccag--------------------------tca---------
H0XQ00_BBC3-01         -cccgccgcctacctctg-------cgcccccaccgccccg---------
H0Y001_HRK-01          -cgggtcgtctgggtctg-------cg----------ctcg---------

H0WYH6_BMF-01          -----------------tcagcccagcctccccaagccagggtgtcatgc
H0XAE7_BIK-01          -----------------cctgcgg---ctagcctgcattggggacgagat
H0XW23_BCL2L11-01      tttgtaagaagatcctccctgctgtctcgatcctccagtgggtatttctc
H0WVR2_BAD-01          -----------------cctgcaggggcagcc------------------
H0XQ00_BBC3-01         -----------------cccgccgtcactgccaccctagggggcccccgc
H0Y001_HRK-01          -----------------tctgccg--------------------------
                                         * **                            

H0WYH6_BMF-01          tgccttgtggggtgactgaagaaccccagagactcttttatggtaatgtt
H0XAE7_BIK-01          ggacctgcatctca------ggagccc---ccgac-----tagcccagct
H0XW23_BCL2L11-01      t--tttgacacagaca----ggagccc---agcacccatgagttgtgaca
H0WVR2_BAD-01          -ggccagcaacacccaccatggagcag---gacct----ggggcagtgga
H0XQ00_BBC3-01         tggcctgggggtcccc----gcagccg---gcccc----gaggcccgcg-
H0Y001_HRK-01          -----cgcagctcaca----gctgccc---ggctc----aaggcgctcg-
                             *             *   *                         

H0WYH6_BMF-01          ggct------------accggcttcctctccctgccagtttccctgcagg
H0XAE7_BIK-01          gtccaggatgaccatgcacagcctg----------ggtctatcctacaac
H0XW23_BCL2L11-01      aatcaacacaaac---ccca------agtcctccttgccaggccttcaac
H0WVR2_BAD-01          gacccggagtcgc---cacagctcgtacccggcagggacagaggaggatg
H0XQ00_BBC3-01         --cctggatggtc---ctcagccatcactcttgccgg-ccgagcagcacc
H0Y001_HRK-01          --gc--gacgagc---tgca-ccagcgcaccatgtgg-cggcgccgcgcg

H0WYH6_BMF-01          cttgcccattggggagcagccccctgaaggg--------caatggcaaca
H0XAE7_BIK-01          caga--ctgatggccagggtgtcctcagaag--tgttatcagcggtttca
H0XW23_BCL2L11-01      cattatctcagtgcaatggcttc--catgaggcagtctcaggccgaacct
H0WVR2_BAD-01          aagggattgaagagcccagccccttccggggccgctcacgctcggcgccc
H0XQ00_BBC3-01         tggagtcgcccgttcccagcacc--ccgggggccctggcgggcggtccca
H0Y001_HRK-01          cggagccggagggcgccagcgcc--cggcgcgctc-----------acca
                                         *   *                         * 

H0WYH6_BMF-01          tcgagc--------agaggtacagatt-----------------------
H0XAE7_BIK-01          ccaacct----cagggagaa------------------------------
H0XW23_BCL2L11-01      gcagatttgcgcccggagatgtggatc-----------------------
H0WVR2_BAD-01          cccaacc--t-ctgggctgcaca---------------------------
H0XQ00_BBC3-01         cccaggcggc-cccggaggtccggggggaggaggagcagtgggccagaga
H0Y001_HRK-01          ccta-ctggc-cctggctgt------------------------------
                        *             *                                  

H0WYH6_BMF-01          -------gcccgaaagcttcagtgcattgcagaccagtttcaccggcttc
H0XAE7_BIK-01          --------------tatagcagggttctggagat--------------cc
H0XW23_BCL2L11-01      -------gcccaagagttgcggcgtattggagacgagtttaacgcttact
H0WVR2_BAD-01          -------gcgc---tatggccgcgaactccgg---------------agg
H0XQ00_BBC3-01         gataggggccc---agctgcggcggatggcggacgacctcaacgcgcagt
H0Y001_HRK-01          -------gcgc---tgccgc-gcaggtggcg------------gcgc---
                                          * *                            

H0WYH6_BMF-01          atgtgcagcaa-------------------------------caccagca
H0XAE7_BIK-01          ctgagccgcgggccctgggtgtgccctg-----------ccccggcgtgg
H0XW23_BCL2L11-01      acc--caacga-------gggtatttttgcataattaccaagcagccgaa
H0WVR2_BAD-01          atgagtgacgagttcgaagactccttcaagaagggacttcctcgcccgaa
H0XQ00_BBC3-01         acgagcggcggagacaagaggagcagcagcgacaccgcccctcaccctgg
H0Y001_HRK-01          -----tggcgg----------------------------------cctgg
                               *                                    *    

H0WYH6_BMF-01          gaac-----caaaatcgtgtgtggtggcaggtcctcttttt--------c
H0XAE7_BIK-01          gaacaggtgctgttgctgctgttgttgctggtgctgctgctggcaggggg
H0XW23_BCL2L11-01      gaccaccctcaaatggttatattacgactgttgc---------------g
H0WVR2_BAD-01          gagcgcaggcacagcgacacagatgcgacagagctccagctggacgcgtg
H0XQ00_BBC3-01         agagtcctgtacaatctcatcatgggactcctgcccttacccaggg---g
H0Y001_HRK-01          ------------------------------ctgctc---------g---g

H0WYH6_BMF-01          ctacacaacctggctttgaacggagaagagaacaggaatggggcaggtcc
H0XAE7_BIK-01          cc------------tgcacctgctg-----------------------ct
H0XW23_BCL2L11-01      ttacatcgtccgcctggtgtggagg-----------------------ct
H0WVR2_BAD-01          tcattcagtcctggtgggatcggaa-----------------------cg
H0XQ00_BBC3-01         ccacagagcccctgaga---tggag-----------------------cc
H0Y001_HRK-01          c-------------agg---cggaa-----------------------ct
                                            *                          * 

H0WYH6_BMF-01          caggtga-------------------------
H0XAE7_BIK-01          caagtga-------------------------
H0XW23_BCL2L11-01      gcactga-------------------------
H0WVR2_BAD-01          tgggcaggggaggttccgccccctgccagtga
H0XQ00_BBC3-01         caattag-------------------------
H0Y001_HRK-01          tg--tag-------------------------

© 1998-2022Legal notice