Dataset for CDS classical BH3-containing proteins of organism Oryzias melastigma

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B3BQF7_BAD-01      atggcagcaaagttctccatctcagacaacgattcggagtc--atccgag
A0A3B3CGR9_BMF-01      atggacgatgag---------gaagacgatgtgttcgagccggaccccaa
                       ****  *   **           **** * *  *  *** *  * ** * 

A0A3B3BQF7_BAD-01      gaggtagagggaggaagacttgacctggcagcatcaggaggagaaggagg
A0A3B3CGR9_BMF-01      caactggcg--------------cacggcgg--tcaggaagataa-----
                        *  * * *              *  *** *  ****** ** **     

A0A3B3BQF7_BAD-01      aggaggaggaggggggcaccttcatgatcga-catgccctcaccctgcca
A0A3B3CGR9_BMF-01      agtgtgaagaccggggcacgcagacgcccggtcctgccctgg---tacca
                       **   ** **  *******    * *  **  * ******     * ***

A0A3B3BQF7_BAD-01      ga---------gcttc------gacttacaagtaacgggcgtacc-----
A0A3B3CGR9_BMF-01      aacaacggcatgcttctctgtggacttgcagagga-gcccagaccacttt
                        *         *****      ***** **    * *  *  ***     

A0A3B3BQF7_BAD-01      ---------aggctgaattcagagtccaccgtttcgacgtactccaga--
A0A3B3CGR9_BMF-01      tctacggtaacgcaggttttcgattgcact-tcccagcacgcttcgagct
                                * ** *  **  ** * ***  *  *  *   ** *     

A0A3B3BQF7_BAD-01      -gatgaagacctcccgcgggaagacgaggctggaacccccaccgacgggt
A0A3B3CGR9_BMF-01      tgctggggatctt-------gaggcgaggcggca--------cgacaggg
                        * **  ** **         ** ****** * *        **** ** 

A0A3B3BQF7_BAD-01      tggccttcaggggccgatccaagtcagcccctccggc-----cttgtggg
A0A3B3CGR9_BMF-01      aagcggagcggggcgggatggag-cggcttccccggcagcagcctgcggc
                         **     ***** *     ** * **  * *****     * ** ** 

A0A3B3BQF7_BAD-01      ccgc--caagaagtacggc------cagcagcttcggaggatgagcgacg
A0A3B3CGR9_BMF-01      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
                        ***  ** * **  * **      *** * ** * *  ***  * *** 

A0A3B3BQF7_BAD-01      agttc------gacagcct---gctggataaaggggagatgaggaaggtg
A0A3B3CGR9_BMF-01      agtttcaccgggaacgcctacaactgtatcatcaaaaccaaaggaa-cca
                       ****       **  ****    *** ** *     *    *****    

A0A3B3BQF7_BAD-01      aggagcgcgggggcgaccaaacagatgcaccactccacgagctggtggaa
A0A3B3CGR9_BMF-01      ggggccgctgtggtg-----------gcgcctcaccacgg----------
                        **  *** * ** *           ** ** * *****           

A0A3B3BQF7_BAD-01      ctacctcttcagccacccggaggccgaaggagagtacagccaccacgaaa
A0A3B3CGR9_BMF-01      --ccctcgtcagccttctattggatagaggct-ttattgctggagggggg
                          **** ******  *    **    ***    **  **      *   

A0A3B3BQF7_BAD-01      gccaccgcaccga-gtag
A0A3B3CGR9_BMF-01      ggtgcaggacaaaggtaa
                       *   * * **  * *** 

© 1998-2022Legal notice