Dataset for CDS classical BH3-containing proteins of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-01      atgtgtctatcgggcatatcaggtcactcgtcttacagtgcccccccccg
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-02      --------------------------------------------------
                                                                         

A0A3P9ICE1_BMF-04      -atg---------------------gacgat------------gaggaag
A0A3P9K487_BMF-02      -atg---------------------gacgat------------gaggaag
A0A3P9K487_BMF-01      -atg---------------------gacgat------------gaggaag
A0A3P9ICE1_BMF-01      tatg---------------------gacgat------------gaggaag
A0A3B3HAU1_BMF-01      -atg---------------------gacgat------------gaggaag
A0A3B3HAU1_BMF-03      -atg---------------------gacgat------------gaggaag
A0A3B3HAU1_BMF-02      -atg---------------------gacgat------------gaggaag
A0A3B3HAU1_BMF-04      -atg---------------------gacgat------------gaggaag
A0A3P9HNZ2_BAD-01      -atggcagcaaagttcaccatctcagacgattcggagtcatccgaggagg
A0A3B3HDU2_BAD-01      -atggcagcaaagttcaccatctcagacgattcggagtcatccgaggagg
A0A3P9KSL7_BAD-01      -atggcagcaaagttcaccatctcagacgattcggagtcatccgaggagg
A0A3P9KSL7_BAD-02      -atggcagcaaagttcaccatctcagacgattcggagtcatccgaggagg
                        ***                     ******            ***** *

A0A3P9ICE1_BMF-04      acgatgtcttcgagccggaccccaacaagtggc-gcacgacagccaggaa
A0A3P9K487_BMF-02      acgatgtgttcgagccggaccccaacaagtggc-gcacgacagccaggaa
A0A3P9K487_BMF-01      acgatgtgttcgagccggaccccaacaagtggc-gcacgacagccaggaa
A0A3P9ICE1_BMF-01      acgatgtcttcgagccggaccccaacaagtggc-gcacgacagccaggaa
A0A3B3HAU1_BMF-01      acgatgtgttcgagccggaccccaacaagtggc-gcacgacagccaggaa
A0A3B3HAU1_BMF-03      acgatgtgttcgagccggaccccaacaagtggc-gcacgacagccaggaa
A0A3B3HAU1_BMF-02      acgatgtgttcgagccggaccccaacaagtggc-gcacgacagccaggaa
A0A3B3HAU1_BMF-04      acgatgtgttcgagccggaccccaacaagtggc-gcacgacagccaggaa
A0A3P9HNZ2_BAD-01      tagagggaggaaaacttgacct--gggagcggcaggaggaggaggaggag
A0A3B3HDU2_BAD-01      tagagggaggaaaacttgacct--gggagcggc---------agcaggag
A0A3P9KSL7_BAD-01      tagagggaggaaaacttgacct--gggagcggc---------agcaggag
A0A3P9KSL7_BAD-02      tagagggaggaaaacttgacct--gggagcggc---------agcaggag
                         ** *      * *  ****      ** ***            **** 

A0A3P9ICE1_BMF-04      gataaagtgtgaagaccggggcac-------gcagacacccggtcctgcc
A0A3P9K487_BMF-02      gataaagtgtgaagaccggggcac-------gcagacacccggtcctgcc
A0A3P9K487_BMF-01      gataaagtgtgaagaccggggcac-------gcagacacccggtcctgcc
A0A3P9ICE1_BMF-01      gataaagtgtgaagaccggggcac-------gcagacacccggtcctgcc
A0A3B3HAU1_BMF-01      gataaagtgtgaagaccggggcac-------gcagacacccggtcctgcc
A0A3B3HAU1_BMF-03      gataaagtgtgaagaccggggcac-------gcagacacccggtcctgcc
A0A3B3HAU1_BMF-02      gataaagtgtgaagaccggggcac-------gcagacacccggtcctgcc
A0A3B3HAU1_BMF-04      gataaagtgtgaagaccggggcac-------gcagacacccggtcctgcc
A0A3P9HNZ2_BAD-01      gagaagg----------ggagcaccttcatgatcgacattc--cctcacc
A0A3B3HDU2_BAD-01      gagaagg----------ggagcaccttcatgatcgacattc--cctcacc
A0A3P9KSL7_BAD-01      gagaagg----------ggagcaccttcatgatcgacattc--cctcaca
A0A3P9KSL7_BAD-02      gagaagg----------ggagcaccttcatgatcgacattc--cctcaca
                       ** ** *          ** ****          ****  *   *   * 

A0A3P9ICE1_BMF-04      ctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccag
A0A3P9K487_BMF-02      ctggtaccaaacaacggcatgcttctctgtggactttcagaggagcccag
A0A3P9K487_BMF-01      ctggtaccaaacaacggcatgcttctctgtggactttcagaggagcccag
A0A3P9ICE1_BMF-01      ctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccag
A0A3B3HAU1_BMF-01      ctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccag
A0A3B3HAU1_BMF-03      ctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccag
A0A3B3HAU1_BMF-02      ctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccag
A0A3B3HAU1_BMF-04      ctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccag
A0A3P9HNZ2_BAD-01      ctg---ccaga---------gcttc------gactcaca-----------
A0A3B3HDU2_BAD-01      ctg---ccaga---------gcttc------gactcaca-----------
A0A3P9KSL7_BAD-01      ctg---ccaga---------gcttc------gactcaca-----------
A0A3P9KSL7_BAD-02      ctg---ccaga---------gcttc------gactcaca-----------
                       ***   *** *         *****      ****  **           

A0A3P9ICE1_BMF-04      accacttttctacggtaacgcaggttttcgattgcacttcccagcacgct
A0A3P9K487_BMF-02      accacttttctacggtaacgcaggttttcgattgcacttcccagcacgct
A0A3P9K487_BMF-01      accacttttctacggtaacgcaggttttcgattgcacttcccagcacgct
A0A3P9ICE1_BMF-01      accacttttctacggtaacgcaggttttcgattgcacttcccagcacgct
A0A3B3HAU1_BMF-01      accacttttctacggtaacgcaggttttcgattgcacttcccagcacgct
A0A3B3HAU1_BMF-03      accacttttctacggtaacgcaggttttcgattgcacttcccagcacgct
A0A3B3HAU1_BMF-02      accacttttctacggtaacgcaggttttcgattgcacttcccagcacgct
A0A3B3HAU1_BMF-04      accacttttctacggtaacgcaggttttcgattgcacttcccagcacgct
A0A3P9HNZ2_BAD-01      -------------agtaacgggcgtaccaggctg-aattcagagtccacc
A0A3B3HDU2_BAD-01      -------------agtaacgggcgtaccaggctg-aattcagagtccacc
A0A3P9KSL7_BAD-01      -------------agtaacgggcgtaccaggctg-aattcagagtccacc
A0A3P9KSL7_BAD-02      -------------agtaacgggcgtaccaggctg-aattcagagtccacc
                                     ******   **    *  ** * ***  **  * * 

A0A3P9ICE1_BMF-04      ttgagcttgctggggatcttgaggtgag--------gcggcacgacaggg
A0A3P9K487_BMF-02      ttgagcttgctggggatcttgaggtgag--------gcggcacgacaggg
A0A3P9K487_BMF-01      ttgagcttgctggggatcttgaggtgag--------gcggcacgacaggg
A0A3P9ICE1_BMF-01      ttgagcttgctggggatcttgaggtgag--------gcggcacgacaggg
A0A3B3HAU1_BMF-01      ttgagcttgctggggatcttgaggtgag--------gcggcacgacaggg
A0A3B3HAU1_BMF-03      ttgagcttgctggggatcttgaggtgag--------gcggcacgacaggg
A0A3B3HAU1_BMF-02      ttgagcttgctggggatcttgaggtgag--------gcggcacgacaggg
A0A3B3HAU1_BMF-04      ttgagcttgctggggatcttgaggtgag--------gcggcacgacaggg
A0A3P9HNZ2_BAD-01      ----gcttccacgtactccagagatgaggacctcgcgcgggaagacgagg
A0A3B3HDU2_BAD-01      ----gcttccacgtactccagagatgaggacctcgcgcgggaagacgagg
A0A3P9KSL7_BAD-01      ----gcttccacgtactccagagatgaggacctcgcgcgggaagacgagg
A0A3P9KSL7_BAD-02      ----gcttccacgtactccagagatgaggacctcgcgcgggaagacgagg
                           **** *  *   **  *** ****        **** * ***  **

A0A3P9ICE1_BMF-04      aagcagagc-----------------------ggcgcgggatggag-cgg
A0A3P9K487_BMF-02      aagcagagc-----------------------ggcgcgggatggag-cgg
A0A3P9K487_BMF-01      aagcagagc-----------------------ggcgcgggatggag-cgg
A0A3P9ICE1_BMF-01      aagcagagc-----------------------ggcgcgggatggag-cgg
A0A3B3HAU1_BMF-01      aagcagagc-----------------------ggcgcgggatggag-cgg
A0A3B3HAU1_BMF-03      aagcagagc-----------------------ggcgcgggatggag-cgg
A0A3B3HAU1_BMF-02      aagcagagc-----------------------ggcgcgggatggag-cgg
A0A3B3HAU1_BMF-04      aagcagagc-----------------------ggcgcgggatggag-cgg
A0A3P9HNZ2_BAD-01      c--cggaacccccactgatgggttggccttcaggggcagatctaagtcgg
A0A3B3HDU2_BAD-01      c--cggaacccccactgatgggttggccttcaggggcagatccaagtcgg
A0A3P9KSL7_BAD-01      c--cggaacccccactgatgggttggccttcaggggcagatccaagtcgg
A0A3P9KSL7_BAD-02      c--cggaacccccactgatgggttggccttcaggggcagatccaagtcgg
                          * ** *                       ** ** *     ** ***

A0A3P9ICE1_BMF-04      cttccccggcagcagcctgtggcacgc-----agcacggaggcctgcatt
A0A3P9K487_BMF-02      cttccccggcagcagcctgtggcacgc-----agcacggaggcctgcatt
A0A3P9K487_BMF-01      cttccccggcagcagcctgtggcacgc-----agcacggaggcctgcatt
A0A3P9ICE1_BMF-01      cttccccggcagcagcctgtggcacgc-----agcacggaggcctgcatt
A0A3B3HAU1_BMF-01      cttccccggcagcagcctgtggcacgc-----agcacggaggcctgcatt
A0A3B3HAU1_BMF-03      cttccccggcagcagcctgtggcacgc-----agcacggaggcctgcatt
A0A3B3HAU1_BMF-02      cttccccggcagcagcctgtggcacgc-----agcacggaggcctgcatt
A0A3B3HAU1_BMF-04      cttccccggcagcagcctgtggcacgc-----agcacggaggcctgcatt
A0A3P9HNZ2_BAD-01      cccctccggc-----cctgtgggccgccaaaaagtacgg-----------
A0A3B3HDU2_BAD-01      cccctccggc-----tctgtgggccgccaaaaagtacgg-----------
A0A3P9KSL7_BAD-01      cccctccggc-----cctgtgggccgccaaaaagtacgg-----------
A0A3P9KSL7_BAD-02      cccctccggc-----cctgtgggccgccaaaaagtacgg-----------
                       *  * *****      ******  ***     ** ****           

A0A3P9ICE1_BMF-04      gcacagaaactccagctgataggggaccagtttcaccgggaacgcctaca
A0A3P9K487_BMF-02      gcacagaaactccagctgataggggaccagtttcaccgggaacgcctaca
A0A3P9K487_BMF-01      gcacagaaactccagctgataggggaccagtttcaccgggaacgcctaca
A0A3P9ICE1_BMF-01      gcacagaaactccagctgataggggaccagtttcaccgggaacgcctaca
A0A3B3HAU1_BMF-01      gcacagaaactccagctgataggggaccagtttcaccgggaacgcctaca
A0A3B3HAU1_BMF-03      gcacagaaactccagctgataggggaccagtttcaccgggaacgcctaca
A0A3B3HAU1_BMF-02      gcacagaaactccagctgataggggaccagtttcaccgggaacgcctaca
A0A3B3HAU1_BMF-04      gcacagaaactccagctgataggggaccagtttcaccgggaacgcctaca
A0A3P9HNZ2_BAD-01      --ccagcagctccgacggatgagcgacgagttt------gacagcct---
A0A3B3HDU2_BAD-01      --tcagcagctccgacggatgagcgacgagttt------gacagcct---
A0A3P9KSL7_BAD-01      --ccagcagctccgacggatgagtgacgagttt------gacagcct---
A0A3P9KSL7_BAD-02      --ccagcagctccgacggatgagtgacgagttt------gacagcct---
                          *** * ****  * ***  * *** *****      **  ****   

A0A3P9ICE1_BMF-04      actgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-----
A0A3P9K487_BMF-02      actgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-----
A0A3P9K487_BMF-01      actgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-----
A0A3P9ICE1_BMF-01      actgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-----
A0A3B3HAU1_BMF-01      actgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-----
A0A3B3HAU1_BMF-03      actgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-----
A0A3B3HAU1_BMF-02      actgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-----
A0A3B3HAU1_BMF-04      actgtatcatcgaaaccaaaggaaccagggg----ccggtgtggt-----
A0A3P9HNZ2_BAD-01      gctggataaaggggagatgaggaaggtgaggagcactggggcggccaaac
A0A3B3HDU2_BAD-01      gctggataaaggggagatgaggaaggtgaggagcactggggcggccaaac
A0A3P9KSL7_BAD-01      gctggataaaggggagatgaggaaggtgaggagcactggggcggccaaac
A0A3P9KSL7_BAD-02      gctggataaaggggagatgaggaaggtgaggagcactggggcggccaaac
                        *** ** *  *  *    *****   * **    * ** * **      

A0A3P9ICE1_BMF-04      ---ggcgcctcgccacg-gct-----------ctcgtcagccttct--at
A0A3P9K487_BMF-02      ---ggcgcctcgccacg-gct-----------ctcgtcagccttct--at
A0A3P9K487_BMF-01      ---ggcgcctcgccacg-gct-----------ctcgtcagccttct--at
A0A3P9ICE1_BMF-01      ---ggcgcctcgccacg-gct-----------ctcgtcagccttct--at
A0A3B3HAU1_BMF-01      ---ggcgcctcgccacg-gct-----------ctcgtcagccttct--at
A0A3B3HAU1_BMF-03      ---ggcgcctcgccacg-gct-----------ctcgtcagccttct--at
A0A3B3HAU1_BMF-02      ---ggcgcctcgccacg-gct-----------ctcgtcagccttct--at
A0A3B3HAU1_BMF-04      ---ggcgcctcgccacg-gct-----------ctcgtcagccttct--at
A0A3P9HNZ2_BAD-01      agatgctccactccacgagctggtggaactacctcttcagccacccggag
A0A3B3HDU2_BAD-01      agatgctccactccacgagctggtggaactacctcttcagccacccggag
A0A3P9KSL7_BAD-01      agatgctccactccacgagctggtggaactacctcttcagccacccggag
A0A3P9KSL7_BAD-02      agatgctccactccacgagctggtggaactacctcttcagccacccggag
                           ** ** * ***** ***           *** ******  *   * 

A0A3P9ICE1_BMF-04      tcgatagaggctttattgctggagcagggggtgcaggacaaaggctatct
A0A3P9K487_BMF-02      tcgatagaggctttattgctggagcagggggtgcaggacaaaggctatct
A0A3P9K487_BMF-01      tcgatagaggctttattgctggagcagggggtgcaggacaaagg------
A0A3P9ICE1_BMF-01      tcgatagaggctttattgctggagcagggggtgcaggacaaaggtaa---
A0A3B3HAU1_BMF-01      tcgatagaggctttattgctggagcagggggtgcaggacaaaggtaa---
A0A3B3HAU1_BMF-03      tcgatagaggctttattgctggagcagggggtgcaggacaaaggtaa---
A0A3B3HAU1_BMF-02      tcgatagaggctttattgctggagcagggggtgcaggacaaaggtaa---
A0A3B3HAU1_BMF-04      tcgatagaggctttattgctggagcagggggtgcaggacaaaggcaatct
A0A3P9HNZ2_BAD-01      gcagaaggaga-gtacagccaccacgagagccaacgcactgag-------
A0A3B3HDU2_BAD-01      gcggaaggaga-gtacagccaccacgagagccaccgcactgag-------
A0A3P9KSL7_BAD-01      gcggaaggaga-gtacagccaccacgagagccaccgcactgagaacagag
A0A3P9KSL7_BAD-02      gcggaaggaga-gtacagccaccacgagagccaccgcactgagaacagag
                        *   **  *   **  **     *  * *     * **  **       

A0A3P9ICE1_BMF-04      gtcttgagtgac--------------------------------------
A0A3P9K487_BMF-02      gtcatgagtgac--------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-04      gtcgtgagtgac--------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      accttctggggtggttgcgttgttcttcggacattacggtcagccatgtc
A0A3P9KSL7_BAD-02      accttctggggtggttgcgttgttcttcggacattacggtcagccatgtc
                                                                         

A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      actgcaggctttcagcttccctttaccagaaactcgttatttcagggctg
A0A3P9KSL7_BAD-02      actgcaggctttcagcttccctttaccagaaactcgttatttcagggctg
                                                                         

A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9HNZ2_BAD-01      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3P9KSL7_BAD-01      gtggtttgatctaccagttcaagatcagaggaggcagcaacttcaggcaa
A0A3P9KSL7_BAD-02      gtggtttgatctaccagttcaagatcagaggaggcagcaacttcagaga-
                                                                         

A0A3P9ICE1_BMF-04      --------------------------------tga
A0A3P9K487_BMF-02      --------------------------------tga
A0A3P9K487_BMF-01      --------------------------------taa
A0A3P9ICE1_BMF-01      -----------------------------------
A0A3B3HAU1_BMF-01      -----------------------------------
A0A3B3HAU1_BMF-03      -----------------------------------
A0A3B3HAU1_BMF-02      -----------------------------------
A0A3B3HAU1_BMF-04      --------------------------------tga
A0A3P9HNZ2_BAD-01      --------------------------------taa
A0A3B3HDU2_BAD-01      --------------------------------taa
A0A3P9KSL7_BAD-01      gacagaactttctagaaccttcaattagaacttga
A0A3P9KSL7_BAD-02      --------------------------------tga
                                                          

© 1998-2020Legal notice