Dataset for CDS BMF of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-01      atgtgtctatcgggcatatcaggtcactcgtcttacagtgcccccccccg
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
                                                                         

A0A3P9ICE1_BMF-04      -atggacgatgaggaagacgatgtcttcgagccggaccccaacaagtggc
A0A3P9K487_BMF-02      -atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggc
A0A3P9K487_BMF-01      -atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggc
A0A3P9ICE1_BMF-01      tatggacgatgaggaagacgatgtcttcgagccggaccccaacaagtggc
A0A3B3HAU1_BMF-01      -atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggc
A0A3B3HAU1_BMF-03      -atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggc
A0A3B3HAU1_BMF-02      -atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggc
A0A3B3HAU1_BMF-04      -atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggc
                        *********************** *************************

A0A3P9ICE1_BMF-04      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3P9K487_BMF-02      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3P9K487_BMF-01      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3P9ICE1_BMF-01      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3B3HAU1_BMF-01      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3B3HAU1_BMF-03      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3B3HAU1_BMF-02      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3B3HAU1_BMF-04      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
                       **************************************************

A0A3P9ICE1_BMF-04      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
A0A3P9K487_BMF-02      ggtcctgccctggtaccaaacaacggcatgcttctctgtggactttcaga
A0A3P9K487_BMF-01      ggtcctgccctggtaccaaacaacggcatgcttctctgtggactttcaga
A0A3P9ICE1_BMF-01      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
A0A3B3HAU1_BMF-01      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
A0A3B3HAU1_BMF-03      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
A0A3B3HAU1_BMF-02      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
A0A3B3HAU1_BMF-04      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
                       ********************************************* ****

A0A3P9ICE1_BMF-04      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3P9K487_BMF-02      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3P9K487_BMF-01      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3P9ICE1_BMF-01      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3B3HAU1_BMF-01      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3B3HAU1_BMF-03      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3B3HAU1_BMF-02      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3B3HAU1_BMF-04      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
                       **************************************************

A0A3P9ICE1_BMF-04      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3P9K487_BMF-02      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3P9K487_BMF-01      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3P9ICE1_BMF-01      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3B3HAU1_BMF-01      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3B3HAU1_BMF-03      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3B3HAU1_BMF-02      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3B3HAU1_BMF-04      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
                       **************************************************

A0A3P9ICE1_BMF-04      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3P9K487_BMF-02      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3P9K487_BMF-01      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3P9ICE1_BMF-01      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3B3HAU1_BMF-01      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3B3HAU1_BMF-03      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3B3HAU1_BMF-02      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3B3HAU1_BMF-04      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
                       **************************************************

A0A3P9ICE1_BMF-04      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3P9K487_BMF-02      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3P9K487_BMF-01      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3P9ICE1_BMF-01      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3B3HAU1_BMF-01      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3B3HAU1_BMF-03      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3B3HAU1_BMF-02      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3B3HAU1_BMF-04      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
                       **************************************************

A0A3P9ICE1_BMF-04      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3P9K487_BMF-02      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3P9K487_BMF-01      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3P9ICE1_BMF-01      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3B3HAU1_BMF-01      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3B3HAU1_BMF-03      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3B3HAU1_BMF-02      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3B3HAU1_BMF-04      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
                       **************************************************

A0A3P9ICE1_BMF-04      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3P9K487_BMF-02      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3P9K487_BMF-01      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3P9ICE1_BMF-01      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3B3HAU1_BMF-01      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3B3HAU1_BMF-03      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3B3HAU1_BMF-02      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3B3HAU1_BMF-04      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
                       **************************************************

A0A3P9ICE1_BMF-04      tagaggctttattgctggagcagggggtgcaggacaaaggctatctgtct
A0A3P9K487_BMF-02      tagaggctttattgctggagcagggggtgcaggacaaaggctatctgtca
A0A3P9K487_BMF-01      tagaggctttattgctggagcagggggtgcaggacaaagg----------
A0A3P9ICE1_BMF-01      tagaggctttattgctggagcagggggtgcaggacaaaggtaa-------
A0A3B3HAU1_BMF-01      tagaggctttattgctggagcagggggtgcaggacaaaggtaa-------
A0A3B3HAU1_BMF-03      tagaggctttattgctggagcagggggtgcaggacaaaggtaa-------
A0A3B3HAU1_BMF-02      tagaggctttattgctggagcagggggtgcaggacaaaggtaa-------
A0A3B3HAU1_BMF-04      tagaggctttattgctggagcagggggtgcaggacaaaggcaatctgtcg
                       ****************************************          

A0A3P9ICE1_BMF-04      tgagtgactga
A0A3P9K487_BMF-02      tgagtgactga
A0A3P9K487_BMF-01      --------taa
A0A3P9ICE1_BMF-01      -----------
A0A3B3HAU1_BMF-01      -----------
A0A3B3HAU1_BMF-03      -----------
A0A3B3HAU1_BMF-02      -----------
A0A3B3HAU1_BMF-04      tgagtgactga
                                  

© 1998-2020Legal notice