Dataset for CDS BMF of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-01      atgtgtctatcgggcatatcaggtcactcgtcttacagtgcccccccccg
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------

A0A3P9K487_BMF-01      -atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggc
A0A3P9K487_BMF-02      -atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggc
A0A3B3HAU1_BMF-01      -atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggc
A0A3B3HAU1_BMF-02      -atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggc
A0A3B3HAU1_BMF-03      -atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggc
A0A3B3HAU1_BMF-04      -atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggc
A0A3P9ICE1_BMF-04      -atggacgatgaggaagacgatgtcttcgagccggaccccaacaagtggc
A0A3P9ICE1_BMF-01      tatggacgatgaggaagacgatgtcttcgagccggaccccaacaagtggc
A0A3P9ICE1_BMF-05      -atggacgatgaggaagacgatgtcttcgagccggaccccaacaagtggc
A0A3P9ICE1_BMF-02      -atggacgatgaggaagacgatgtcttcgagccggaccccaacaagtggc
A0A3P9ICE1_BMF-03      -atggacgatgaggaagacgatgtcttcgagccggaccccaacaagtggc
                        *********************** *************************

A0A3P9K487_BMF-01      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3P9K487_BMF-02      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3B3HAU1_BMF-01      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3B3HAU1_BMF-02      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3B3HAU1_BMF-03      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3B3HAU1_BMF-04      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3P9ICE1_BMF-04      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3P9ICE1_BMF-01      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3P9ICE1_BMF-05      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3P9ICE1_BMF-02      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc
A0A3P9ICE1_BMF-03      gcacgacagccaggaagataaagtgtgaagaccggggcacgcagacaccc

A0A3P9K487_BMF-01      ggtcctgccctggtaccaaacaacggcatgcttctctgtggactttcaga
A0A3P9K487_BMF-02      ggtcctgccctggtaccaaacaacggcatgcttctctgtggactttcaga
A0A3B3HAU1_BMF-01      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
A0A3B3HAU1_BMF-02      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
A0A3B3HAU1_BMF-03      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
A0A3B3HAU1_BMF-04      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
A0A3P9ICE1_BMF-04      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
A0A3P9ICE1_BMF-01      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
A0A3P9ICE1_BMF-05      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
A0A3P9ICE1_BMF-02      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
A0A3P9ICE1_BMF-03      ggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcaga
                       ********************************************* ****

A0A3P9K487_BMF-01      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3P9K487_BMF-02      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3B3HAU1_BMF-01      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3B3HAU1_BMF-02      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3B3HAU1_BMF-03      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3B3HAU1_BMF-04      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3P9ICE1_BMF-04      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3P9ICE1_BMF-01      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3P9ICE1_BMF-05      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3P9ICE1_BMF-02      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc
A0A3P9ICE1_BMF-03      ggagcccagaccacttttctacggtaacgcaggttttcgattgcacttcc

A0A3P9K487_BMF-01      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3P9K487_BMF-02      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3B3HAU1_BMF-01      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3B3HAU1_BMF-02      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3B3HAU1_BMF-03      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3B3HAU1_BMF-04      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3P9ICE1_BMF-04      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3P9ICE1_BMF-01      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3P9ICE1_BMF-05      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3P9ICE1_BMF-02      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg
A0A3P9ICE1_BMF-03      cagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagg

A0A3P9K487_BMF-01      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3P9K487_BMF-02      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3B3HAU1_BMF-01      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3B3HAU1_BMF-02      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3B3HAU1_BMF-03      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3B3HAU1_BMF-04      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3P9ICE1_BMF-04      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3P9ICE1_BMF-01      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3P9ICE1_BMF-05      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3P9ICE1_BMF-02      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc
A0A3P9ICE1_BMF-03      gaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggc

A0A3P9K487_BMF-01      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3P9K487_BMF-02      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3B3HAU1_BMF-01      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3B3HAU1_BMF-02      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3B3HAU1_BMF-03      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3B3HAU1_BMF-04      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3P9ICE1_BMF-04      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3P9ICE1_BMF-01      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3P9ICE1_BMF-05      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3P9ICE1_BMF-02      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
A0A3P9ICE1_BMF-03      acgcagcacggaggcctgcattgcacagaaactccagctgataggggacc

A0A3P9K487_BMF-01      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3P9K487_BMF-02      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3B3HAU1_BMF-01      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3B3HAU1_BMF-02      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3B3HAU1_BMF-03      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3B3HAU1_BMF-04      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3P9ICE1_BMF-04      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3P9ICE1_BMF-01      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3P9ICE1_BMF-05      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3P9ICE1_BMF-02      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag
A0A3P9ICE1_BMF-03      agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccag

A0A3P9K487_BMF-01      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3P9K487_BMF-02      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3B3HAU1_BMF-01      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3B3HAU1_BMF-02      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3B3HAU1_BMF-03      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3B3HAU1_BMF-04      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3P9ICE1_BMF-04      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3P9ICE1_BMF-01      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3P9ICE1_BMF-05      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3P9ICE1_BMF-02      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga
A0A3P9ICE1_BMF-03      gggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcga

A0A3P9K487_BMF-01      tagaggctttattgctggagcagggggtgcaggacaaagg----------
A0A3P9K487_BMF-02      tagaggctttattgctggagcagggggtgcaggacaaaggctatctgtca
A0A3B3HAU1_BMF-01      tagaggctttattgctggagcagggggtgcaggacaaaggtaa-------
A0A3B3HAU1_BMF-02      tagaggctttattgctggagcagggggtgcaggacaaaggtaa-------
A0A3B3HAU1_BMF-03      tagaggctttattgctggagcagggggtgcaggacaaaggtaa-------
A0A3B3HAU1_BMF-04      tagaggctttattgctggagcagggggtgcaggacaaaggcaatctgtcg
A0A3P9ICE1_BMF-04      tagaggctttattgctggagcagggggtgcaggacaaaggctatctgtct
A0A3P9ICE1_BMF-01      tagaggctttattgctggagcagggggtgcaggacaaagg----------
A0A3P9ICE1_BMF-05      tagaggctttattgctggagcagggggtgcaggacaaagg----------
A0A3P9ICE1_BMF-02      tagaggctttattgctggagcagggggtgcaggacaaagg----------
A0A3P9ICE1_BMF-03      tagaggctttattgctggagcagggggtgcaggacaaagg----------

A0A3P9K487_BMF-01      --------taa
A0A3P9K487_BMF-02      tgagtgactga
A0A3B3HAU1_BMF-01      -----------
A0A3B3HAU1_BMF-02      -----------
A0A3B3HAU1_BMF-03      -----------
A0A3B3HAU1_BMF-04      tgagtgactga
A0A3P9ICE1_BMF-04      tgagtgactga
A0A3P9ICE1_BMF-01      --------taa
A0A3P9ICE1_BMF-05      --------taa
A0A3P9ICE1_BMF-02      --------taa
A0A3P9ICE1_BMF-03      --------taa

© 1998-2020Legal notice