Dataset for CDS classical BH3-containing proteins of organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A5F9C629_PMAIP1-      --------------atgccc------------------------------
A0A5F9C9V3_BCL2L11      --------------atggccaagcaaccttccgatgtaagttctgagtgt
A0A5F9C9V3_BCL2L11      --------------atggccaagcaaccttccgatgtaagttctgagtgt
A0A5F9DGT6_BBC3-01      --------------atggcccgcg--------cacgccaggagggcagct
G1T7W1_HRK-01           --------------atg---------------------------------
G1SR62_BMF-01           atggagccacctcagtgtgtggag---gagctgg----aggatgacgtgt
G1TZR9_BIK-01           --------------atgtctgaagtcagacctggctccagg--gacctct

A0A5F9C629_PMAIP1-      ----------------------------gggaagagggcgcgcaagaga-
A0A5F9C9V3_BCL2L11      gaca------------------------gagaaggtggacagttgcagcc
A0A5F9C9V3_BCL2L11      gaca------------------------gagaaggtggacagttgcagcc
A0A5F9DGT6_BBC3-01      ctcc------------ggagcc--cgtagagggcctggcccgcgacggcc
G1T7W1_HRK-01           ----------------------------------------------tgcc
G1SR62_BMF-01           tccagccagaggacggggagcc------ggggacccagccc----caaag
G1TZR9_BIK-01           tcca-----------ggaagccctcctggatgagcaggtcc----cagaa

A0A5F9C629_PMAIP1-      -------------tctcaatcgag--------------------------
A0A5F9C9V3_BCL2L11      tgcggagaggccgccccagctcag-------gcctggggcc--cccacct
A0A5F9C9V3_BCL2L11      tgcggagaggccgccccagctcag-------gcctggggcc--cccacct
A0A5F9DGT6_BBC3-01      ctcgc--------ccccttcccgc-ttggtcgcctggtgcc--ctcggcc
G1T7W1_HRK-01           cgtgc--------cccctgcac-c-gtggccgc---ggccc--cccggcc
G1SR62_BMF-01           cttgc--------tctctgctgac-ccgtttgcccagagccagctggact
G1TZR9_BIK-01           c-------------ctctgttgacggcggaagttcccggc---ctgaccc
                                      * *                                 

A0A5F9C629_PMAIP1-      -------tccgaagc-------gagcgcca--------------------
A0A5F9C9V3_BCL2L11      c------cctgcagt-----cggagccgca--------------------
A0A5F9C9V3_BCL2L11      c------cctgcagt-----cggagccgcaaggtaatccggaaggcgacc
A0A5F9DGT6_BBC3-01      gtgt---cctgcggccttctgcgagcggga---agtccctcctggaatct
G1T7W1_HRK-01           gtgtgcgcctgcagc---------gcggg--------ccgcctgggg-ct
G1SR62_BMF-01           gccc---cctggggc--------ggctgcacctcttccctctcacccact
G1TZR9_BIK-01           gtcc---cgtggagg--------aagggga---cttggatctcatggagt
                                  *  *                                    

A0A5F9C629_PMAIP1-      --------------------gcagagctggaagtcgaatgtgccact---
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      gctgtgcgcacg--------gcagccctcagggcccgctggccccatcgg
A0A5F9DGT6_BBC3-01      gact----------------gcagtccccgagctgcg----gccggc---
G1T7W1_HRK-01           gcgc----------------tcggccgccgcgcagctcaccgccgcc---
G1SR62_BMF-01           gct-----------------gtggtcctg-ggctgcgacccaccagccag
G1TZR9_BIK-01           gcctcgagggcagtaaccaggtggccctgaggctggcgtacatcggc---

A0A5F9C629_PMAIP1-      ---------------caactcaggatcatcgg------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      ccagccctggccctttcgctaccaggtccccgctcttcatctttgtccga
A0A5F9DGT6_BBC3-01      ---------------gggctc----ctcccgg-------cctccagccac
G1T7W1_HRK-01           ---------------cggctcaaggcactcgg-------cgacgagctgc
G1SR62_BMF-01           gaagacaaggccacccagaccctcagccccgcct-----ccccgagccaa
G1TZR9_BIK-01           ---gacgaga-----tggacctgcacccccgacggtacacctctgcccgg

A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      agatcctccctgctgtctcgatcgtccagtgggtatttctcttttgacac
A0A5F9DGT6_BBC3-01      agcggtttcccagcgcccctcccccggcctgggc-------ccccgcgac
G1T7W1_HRK-01           a--------ccagcgcacc-------atgtgg-----------cggcgcc
G1SR62_BMF-01           ggggtcatgctgccttgtg-------gggtgaccgaggaaccccagcgac
G1TZR9_BIK-01           ctgcttgttccgtcttaca-------gcttggcc---------------t

A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A5F9C9V3_BCL2L11      agacaggagcccggcacccatgagctgtgacaaatcaacacaaacccc--
A0A5F9C9V3_BCL2L11      agacaggagcccggcacccatgagctgtgacaaatcaacacaaacccc--
A0A5F9DGT6_BBC3-01      ccccacggggctcgcagttggaaggag-ggccagtcactggagtcgtc--
G1T7W1_HRK-01           gcgcgcggagcc-----------ggag-ggc---------------gc--
G1SR62_BMF-01           tcttttatggca----------atgct-ggc--t--accggctccctct-
G1TZR9_BIK-01           tcacctacagcc----------agacg-ggc--ttcacgggtgttctcgg

A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A5F9C9V3_BCL2L11      --------aagtcctccttgccaggccttcaaccactatctcagtgcaat
A0A5F9C9V3_BCL2L11      --------aagtcctccttgccaggccttcaaccactatctcagtgcaat
A0A5F9DGT6_BBC3-01      ---------------ccgtgcccagcgccccggggg----cccctggagg
G1T7W1_HRK-01           ---------------cggcgcccggcgc----------------------
G1SR62_BMF-01           ---------------ccctgccagtttccctgcaaacttcgcgctggggg
G1TZR9_BIK-01           aagcgtggggctccaccttgccag---cctcgtaga----gctctggag-

A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A5F9C9V3_BCL2L11      gggtaagca-----------aagcctgggtaagacgaagccagcatacgg
A0A5F9C9V3_BCL2L11      ggcttccat-----------gaggcagtctcaggctgaacctgcagacac
A0A5F9DGT6_BBC3-01      gggtccccaccccggcggccccgggagtctggggcgaggaggagcagtgg
G1T7W1_HRK-01           -gctcccca-cctactggccctggctgtgcgcggc---------------
G1SR62_BMF-01           agcagcccc-ctgaagggcagtggcagcatcgagc------------aga
G1TZR9_BIK-01           ------ccc-ctg------ggtaagagcttgg----------------gg

A0A5F9C629_PMAIP1-      -----agataaactggat--------------------------------
A0A5F9C9V3_BCL2L11      gtgtctgcatagctgtgt-------gtgtggcgtc----------cacgt
A0A5F9C9V3_BCL2L11      gcgtccggagacctggatcgcgcaggagttgcggcggatcggagacgagt
A0A5F9DGT6_BBC3-01      gcccgagagatcgtggcc-------cagctgcggtggatggcgtacgatc
G1T7W1_HRK-01           --------------------------------------------------
G1SR62_BMF-01           ggtccagattgctcggaa---------gcttcagtgcattgctgaccagt
G1TZR9_BIK-01           ggccc------cttggag-------ccgcttctgc------ctgtccggt

A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A5F9C9V3_BCL2L11      t--acgt-----------------------gtattttacttttcctgaaa
A0A5F9C9V3_BCL2L11      tcaacgc-----------------------gtattaccc----------a
A0A5F9DGT6_BBC3-01      tgtacgcg--------------------cagtatgagcgcagacaagagg
G1T7W1_HRK-01           ----cgcg--------------------cag-------------------
G1SR62_BMF-01           t--ccaccggcttcatttacagcaacaccagcagaaccgaaatcgcgtgt
G1TZR9_BIK-01           ttgccactgtcccc----------accccagcctgatc------------

A0A5F9C629_PMAIP1-      ---------------------------ttgcgcagaaaa-----------
A0A5F9C9V3_BCL2L11      ggtagaggttttccatcagctggttgcttccccagatgcccaccacggcc
A0A5F9C9V3_BCL2L11      cgcagggttttt-------ttgaataattacccagcagc-----------
A0A5F9DGT6_BBC3-01      agcagcagcgac-------accgcccttcgccctggagg-----------
G1T7W1_HRK-01           -gtggcggcg----------------------------------------
G1SR62_BMF-01           ggtggcagatcc-------tcctcttcctgcacaacctg-----------
G1TZR9_BIK-01           --ctgcaggcct-------ctgggtcggtgcccaggcta-----------

A0A5F9C629_PMAIP1-      -ctactgaa-----------------------------tctcatatctaa
A0A5F9C9V3_BCL2L11      tggactggactgggccaggccaaagccaggagcctggaact-tggctctg
A0A5F9C9V3_BCL2L11      ------gga--ggagcagccccaaatggttatcttgcgactgttgcgtta
A0A5F9DGT6_BBC3-01      -gtcctgtacaatcttctcatgggacttctgcccttacccaggggccccg
G1T7W1_HRK-01           --------------------------------------ctggcggcctgg
G1SR62_BMF-01           -gctctgaatggtga-------------------------cgagaacag-
G1TZR9_BIK-01           -g--ctgggtggacataag-------------------cctgagaccagt

A0A5F9C629_PMAIP1-      gttcttcaacttcg-----------tcccctga
A0A5F9C9V3_BCL2L11      agtctcccgcctgggtggcagggaccgagctag
A0A5F9C9V3_BCL2L11      catcgtgcgcctgg--tgtggaggatgcattga
A0A5F9DGT6_BBC3-01      gagcc----ccgga--gatggagccca-actag
G1T7W1_HRK-01           ctgct----cggca--ggcggaacttg---tag
G1SR62_BMF-01           -ggat-------gg--ggcaggtccta-ggtga
G1TZR9_BIK-01           cggctgccacccgg--agcag--cact-gctga

© 1998-2021Legal notice