Dataset for CDS classical BH3-containing proteins of organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1SR62_BMF-01          atggagccacctcagt---------gtgtggag---gagctgg----agg
G1TZR9_BIK-01          --------------at---------gtctgaagtcagacctggctccagg
G1T7W1_HRK-01          --------------------------------atgtgcccg---------
G1SSY0_BCL2L11-01      atggccaagcaaccttccgatgtaagttctgagtgtgacagag----aag
G1SSY0_BCL2L11-02      atggccaagcaaccttccgatgtaagttctgagtgtgacagag----aag
                                                           *             

G1SR62_BMF-01          atgacgtgttccagccagaggacggggagcc------ggggacccagccc
G1TZR9_BIK-01          --gacctcttcca-----------ggaagccctcctggatgagcaggtcc
G1T7W1_HRK-01          ---------tgccccctgcaccgtggccgcggccc-------------cc
G1SSY0_BCL2L11-01      gtggacagttgcagcctgcggagaggccgccccag-------------ct
G1SSY0_BCL2L11-02      gtggacagttgcagcctgcggagaggccgccccag-------------ct
                                * *            **  **                  * 

G1SR62_BMF-01          caaagcttgctctctgctgac-ccgtttgcccagagccagctggactgcc
G1TZR9_BIK-01          cagaac-----ctctgttgacggcggaagttcccggc---ctgacccgtc
G1T7W1_HRK-01          cgg--------ccgtgtg---------cgcctgcagc---gcgggccg--
G1SSY0_BCL2L11-01      cag--------gcctggggcccccacctccctgcagt---cggagccgca
G1SSY0_BCL2L11-02      cag--------gcctggggcccccacctccctgcagt---cggagccgca
                       *             **                   *      *  * *  

G1SR62_BMF-01          ccctggggcggctgcacctcttccctctcacccactgct-----------
G1TZR9_BIK-01          ccgtggaggaagggga---cttggatctcatggagtgcctcga-------
G1T7W1_HRK-01          --------------------------------------------------
G1SSY0_BCL2L11-01      --------------------------------------------------
G1SSY0_BCL2L11-02      aggtaatccggaaggcgaccgctgtgcgcacggcagccctcagggcccgc
                                                                         

G1SR62_BMF-01          --------------------------------------------------
G1TZR9_BIK-01          --------------------------------------------------
G1T7W1_HRK-01          --------------------------------------------------
G1SSY0_BCL2L11-01      --------------------------------------------------
G1SSY0_BCL2L11-02      tggccccatcggccagccctggccctttcgctaccaggtccccgctcttc
                                                                         

G1SR62_BMF-01          --------------------------------------------------
G1TZR9_BIK-01          --------------------------------------------------
G1T7W1_HRK-01          --------------------------------------------------
G1SSY0_BCL2L11-01      --------------------------------------------------
G1SSY0_BCL2L11-02      atctttgtccgaagatcctccctgctgtctcgatcgtccagtgggtattt
                                                                         

G1SR62_BMF-01          -------------------------gtggtcctg-ggctgcgacccacca
G1TZR9_BIK-01          ------------gggcagtaaccaggtggccctgaggctggcgtacatcg
G1T7W1_HRK-01          -----------------------------cctgg-ggctgcgctcggccg
G1SSY0_BCL2L11-01      ------------agacaggagcccggcacccatg-agctgtgacaaatca
G1SSY0_BCL2L11-02      ctcttttgacacagacaggagcccggcacccatg-agctgtgacaaatca
                                                     *  *  ****        * 

G1SR62_BMF-01          gccaggaagacaaggccacccagaccctcagccccgcct-----ccccga
G1TZR9_BIK-01          gc------gacgaga-----tggacctgcacccccgacggtacacctctg
G1T7W1_HRK-01          ccgcgcagctcaccgccgcccggctcaaggcactcggcg-----------
G1SSY0_BCL2L11-01      acacaaaccccaagtcctccttgcc--aggccttcaacc-----------
G1SSY0_BCL2L11-02      acacaaaccccaagtcctccttgcc--aggccttcaacc-----------
                        *        *           *           *  *            

G1SR62_BMF-01          gccaaggggtcatgctgccttgtggggtgaccgaggaaccccagcgactc
G1TZR9_BIK-01          cccggctgcttgttccgtcttacagcttggcc---------------ttc
G1T7W1_HRK-01          --------------------------------------------------
G1SSY0_BCL2L11-01      --------------------------------------------------
G1SSY0_BCL2L11-02      --------------------------------------------------
                                                                         

G1SR62_BMF-01          ttttatggcaatgctggct--accggctccctct----------------
G1TZR9_BIK-01          acctacagccagacgggcttcacgggtgttctcggaagcgtggggctcca
G1T7W1_HRK-01          ------------acgagctgcaccagcgcaccatgt--------------
G1SSY0_BCL2L11-01      ------------actatct----cagtgcaatgggtaagcaaagcctggg
G1SSY0_BCL2L11-02      ------------actatct----cagtgcaatggcttccatgaggcagtc
                                    *   **      *                        

G1SR62_BMF-01          ccctgccagtttccctgcaaacttcgcgctgggggagcagccccctgaag
G1TZR9_BIK-01          ccttgccag---cctcgtaga----gctctggag-------cccctg---
G1T7W1_HRK-01          ---ggcggc---gcc-----------gcgcgcgg----------------
G1SSY0_BCL2L11-01      taagacgaa---gccagcatacgggtgtctgcat----------------
G1SSY0_BCL2L11-02      tcaggctga---acctgcagacacgcgtccggag----------------
                            *       *                *                   

G1SR62_BMF-01          ggcagtggcagcatcgagcagaggtccagattgctcggaa--gcttcagt
G1TZR9_BIK-01          ---ggtaagagcttgg----ggggccc------cttggagccgcttctgc
G1T7W1_HRK-01          ------agccgga--------gggcgccggcgcccgg----cgcgctccc
G1SSY0_BCL2L11-01      ------agctgtgt-------gtgtggcgtc----------cacgtt--a
G1SSY0_BCL2L11-02      ------acctggatcgcgcaggagttgcggcggatcggagacgagttcaa
                                 *            *                          

G1SR62_BMF-01          gcattgctgacc-----------------agtt--cca----ccggcttc
G1TZR9_BIK-01          ------ctgtcc-----------------ggtttgcca----ctgtcccc
G1T7W1_HRK-01          cacctactggcc------------------------------ctggctg-
G1SSY0_BCL2L11-01      cgtgtattttacttttcctgaaaggtagaggttttccatcagctggttgc
G1SSY0_BCL2L11-02      cgcgtattaccc----------acgcagggttttt-------ttgaataa
                              *   *                                *     

G1SR62_BMF-01          atttacagcaacaccagcagaaccgaaatcgcgtgtggtggc---agatc
G1TZR9_BIK-01          ----------accccagcctgatc--------------ctgc---aggcc
G1T7W1_HRK-01          -tgcgcggccgcgcag------------------gtggcggc--------
G1SSY0_BCL2L11-01      ttccccagatgcccaccacggcctggactggactgggccaggccaaagcc
G1SSY0_BCL2L11-02      ttacccagcagc-----------------gga--ggagcagccccaaatg
                                  *                            *         

G1SR62_BMF-01          ctcctcttcctgcacaacc-tggctctgaatggtga------cgagaaca
G1TZR9_BIK-01          tctgggtcggtgcccaggc-tag--ctgggtggacataagcctgagacca
G1T7W1_HRK-01          ----gctgg-----cggcc-tggct--------------------gctcg
G1SSY0_BCL2L11-01      aggagcctg-----gaact-tggctctgagtct---------cccgcctg
G1SSY0_BCL2L11-02      gttatcttg-----cgactgttgcgttacatcg---------tgcgcctg
                                           * *                      *    

G1SR62_BMF-01          g--ggat-------ggggcaggtcctaggtga
G1TZR9_BIK-01          gtcggctgccacccggagcag--cactgctga
G1T7W1_HRK-01          gcaggcg-------gaacttg--------tag
G1SSY0_BCL2L11-01      ggtggca-------gggaccg-----agctag
G1SSY0_BCL2L11-02      g--tgtg-------gaggatg-----cattga
                       *   *         *     *        *  

© 1998-2020Legal notice