Dataset for CDS classical BH3-containing proteins of organism Oreochromis niloticus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


I3K2D6_BMF-01      atg---------------------gacgatgaggagga------cgatgtgtttgagcca
I3K7B6_BAD-01      atggctgcaaacttcacaatttcagacagtgaatcggagacatcagaggaggtaggggaa
                   ***                     ***  ***   ***       ** * * * * *  *

I3K2D6_BMF-01      aaagccaactgttggcgcaccacattcagggagataaagtgtgaacatcgaggcacacag
I3K7B6_BAD-01      gaagaaaac----------caacagccagcaggacaagatcaagaaagcaag--ccccag
                    ***  ***          * ***  ***   ** **  *    * * * **   * ***

I3K2D6_BMF-01      acacccggtcctgccctggtaccaaacaacggca--tgctgccctgtggagtcgcaga-g
I3K7B6_BAD-01      acacttg--cccttcctgtaatcaa--aacgacaggtgctg------gaaggctcaggct
                   ****  *  **   ****  * ***  **** **  *****      * ** * ***   

I3K2D6_BMF-01      gagcccaga---ccactcttctacggtaacgcaggttttcgattgcacttcccggc----
I3K7B6_BAD-01      aaactcagagtcccacacttcctcagttgc-cagggatgagg----acctcatggctaga
                    * * ****   **** ****  * **  * ****  *  *     ** **  ***    

I3K2D6_BMF-01      ---------acgcttcgaactcgtcggggatcacagagcgaggcgacaagaaatcgcgga
I3K7B6_BAD-01      ggggaggatgaggtctgtactc--------ccacagagggagac-ccattcaggcgaagg
                              * *  * ****         ******* *** *  **   *  **  * 

I3K2D6_BMF-01      gcagcaaaacagcatggagcgcctgccccggcagcgacctgcggctcgcagcgtggaggc
I3K7B6_BAD-01      tca--aagtcag----------ctccccctgc-----tctgtgg---gctgccaagaagt
                    **  **  ***          ** **** **      *** **   ** **   ** * 

I3K2D6_BMF-01      ctgcatcggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaact
I3K7B6_BAD-01      a-----cggccagaagcttcgacggatgagtgacgagttt------gacagccta-----
                         *** ***** ** *  *  **  * *** *****      **  ****      

I3K2D6_BMF-01      gtatcaccgaaaccaaaggaaccaggggccaatgtggtggcgcctggccgcggcccttct
I3K7B6_BAD-01      -------ctagataaaggggagatgaagctcaagaagctgcaccactctaaaacctggtg
                          * * *  ** ** *   *  **  * *  *  ** **   *     **     

I3K2D6_BMF-01      cagccttctgtttga----cagggggttcatagccggaggaggggg--------tggagg
I3K7B6_BAD-01      gagctacctctttagtcaccaagag-------actgaaggagagaacaaccatcttgaaa
                    ***   ** ***      ** * *        * * ***** *          * **  

I3K2D6_BMF-01      acgg-------------aggtga
I3K7B6_BAD-01      accacaaccaacgcactgagtaa
                   **                 ** *

© 1998-2020Legal notice