Dataset for CDS classical BH3-containing proteins of organism Oreochromis niloticus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A669C520_BCL2L11      ------------tacttatttgaaaatgctgatatgcaggctgactgcg-
I3K2D6_BMF-01           atg---------------------gacgatgaggagga------cgatgt
I3K7B6_BAD-01           atggctgcaaacttcacaatttcagacagtgaatcggagacatcagagga
                                                 *   ***   * *          * 

A0A669C520_BCL2L11      gtctgcgc----atttatttctggctgtttctctgtgacgcagctgaagt
I3K2D6_BMF-01           gtttgagccaaaagccaactgttggcgcaccacattcagggagataaagt
I3K7B6_BAD-01           ggtaggggaagaagaaaac----------caacagccagcaggacaagat
                        *   * *     *   *               *    *    *   *  *

A0A669C520_BCL2L11      c---actctggggcttcctcatg------cttttcctataaggcaaacag
I3K2D6_BMF-01           gtgaacatcgaggcacacagacacccggtcctgccctggta-ccaaacaa
I3K7B6_BAD-01           caagaaagcaag--ccccagacacttg--cccttcctgtaa-tcaa--aa
                            *      *     *  *        *    ***   *  ***  * 

A0A669C520_BCL2L11      agatgtatctaccacctgtcggtgccacagg---agctcaaacatcccgt
I3K2D6_BMF-01           cg--gca--tgctgccctgtggagtcgcaga-ggagcccaga--------
I3K7B6_BAD-01           cg--acaggtgctg------gaaggctcaggctaaactcaga--------
                         *    *  * *        *  * * ***    * * ** *        

A0A669C520_BCL2L11      ttaaaccgcggctctaccggaggaggagaaccggattcgccttcctggtg
I3K2D6_BMF-01           -----ccactcttctacggtaacgcaggttttcgattgcacttcccggc-
I3K7B6_BAD-01           --gtcccacacttcctcagttgc-cagggatgagg----acctcatggct
                             ** *   **  * *        *     *      * **  **  

A0A669C520_BCL2L11      cagaaccccgaagagctttgacgtt--------tttcagagccggacgat
I3K2D6_BMF-01           ------------acgcttcgaactcgtcggggatcacagagcgaggcgac
I3K7B6_BAD-01           agaggggaggatgaggtctgtactc--------ccacagagggagac-cc
                                      * *  *   *            *****   * *   

A0A669C520_BCL2L11      attccgcttccctcgccgttcctccagtggatatt------tttcctctg
I3K2D6_BMF-01           aagaaa------tcgcggagcagcaaaacagcatggagcgcctgccccgg
I3K7B6_BAD-01           attcag------gcgaaggtca--aagtcag----------ctccccctg
                        *            **  *  *    *                * ** * *

A0A669C520_BCL2L11      a------ctgcgactcgttgccgagctctccgctctccccgaagccagtg
I3K2D6_BMF-01           cagcgacctgcggctcgcagcgtg----------------gaggcctg--
I3K7B6_BAD-01           c-----tctgtgg---gctgccaa----------------gaagta----
                               *** *    *  **                   ** *      

A0A669C520_BCL2L11      atgtctgacaaagcgatacagaccccgagccccaccggacaggtgctaat
I3K2D6_BMF-01           --------------------------------catcggacagaaactc--
I3K7B6_BAD-01           -----------------------------------cggccagaagctt--
                                                           *** ***   **   

A0A669C520_BCL2L11      acacgccctgcagcgcatgggtgaggtgcgcggtgaaggaccgggcacgc
I3K2D6_BMF-01           ----------cagctcataggaga---------------------ccagt
I3K7B6_BAD-01           ----------cgacggatgagtga---------------------cgagt
                                  *  *  **  * **                     *  * 

A0A669C520_BCL2L11      aacacggtgagcacagactcttcatgtataacagccgcattaatgtgagt
I3K2D6_BMF-01           ttcactgggaacgc-----ctgcaactgtatcaccgaaaccaaaggaacc
I3K7B6_BAD-01           tt------gacagc-----cta------------ctagataaaggggaga
                                **   *     **             *   *  ** *  *  

A0A669C520_BCL2L11      gcacgcacgtggaggagtgttactaatgatagtgaaaagatgaacaaaaa
I3K2D6_BMF-01           aggggccaatgtggtggcgcctgg--------------------ccgcgg
I3K7B6_BAD-01           tgaagctcaagaagctgcaccact--------------------ctaaaa
                            **    *  *  *                           *     

A0A669C520_BCL2L11      catacttaggatgttttgctatctagtttcatacttaagatgtgtttgtt
I3K2D6_BMF-01           ccc--------ttctcagccttct-gtttga----cagggggt-------
I3K7B6_BAD-01           cct--------ggtggagctacct-ctttagtcaccaagag---------
                        *                **   **  ***       * *           

A0A669C520_BCL2L11      ttcacccctttctcactgtcgagcttagtcatgaaagagagccgtttttc
I3K2D6_BMF-01           ----------------------tcatagccggaggaggggg---------
I3K7B6_BAD-01           ---------------------------actgaaggagagaa---------
                                                           ** *           

A0A669C520_BCL2L11      cactactctgatgtgctgtgcttgctattctcacatgagtaa
I3K2D6_BMF-01           --------tggaggacgg------------------aggtga
I3K7B6_BAD-01           caaccatcttgaaaaccacaaccaacgcac-----tgagtaa
                                *      *                      ** *

© 1998-2022Legal notice