Dataset for CDS BAD of organism Oncorhynchus mykiss

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A060W8P9_BAD-01      atgaaccacacacatgattgtgtggatgacaatccagaaaccatgaatga
A0A060W8W7_BAD-01      atggaccacatacatgattgtgtggatg----------------------
                       *** ****** *****************                      

A0A060W8P9_BAD-01      acaagatgagtctgaccactcaggaaccacacactaccccgaatttcagc
A0A060W8W7_BAD-01      --aatgtgagtctgaccactcaggaaccacacacaactctgaatttcagc
                         **  **************************** ** * **********

A0A060W8P9_BAD-01      tccataatgtctccactacgacgagcatcagaccacgaccaggtgggcga
A0A060W8W7_BAD-01      tcc---atgtctcaactacaatgagcaacagaccaagaccaggtgagcga
                       ***   ******* ***** * ***** ******* ********* ****

A0A060W8P9_BAD-01      gctcggctctactccgagtcccaggtgtgctcccaggttggcagaaggga
A0A060W8W7_BAD-01      gtccggctctactcagagtcccaggtgtgctcccaggttggaaaaaggga
                       *  *********** ************************** * ******

A0A060W8P9_BAD-01      tgacacagagtttcaggatgcaataactcctactgaggagggcgggggcg
A0A060W8W7_BAD-01      agacacagagtttcaggatgtgatgactcctactgaggatggcgggggtg
                        *******************  ** ************** ******** *

A0A060W8P9_BAD-01      atggggctcctttccgaagccgatcacagtctgctcctcctacactgtgg
A0A060W8W7_BAD-01      atggggcttcattccgaggccgatcacagtctgctcctcctgcactgtgg
                       ******** * ****** *********************** ********

A0A060W8P9_BAD-01      gctgcaaagaaatatggccgccagctgaggaggatgagtgatgaatttga
A0A060W8W7_BAD-01      gctgcaaagaaatatggctgccagctgaggaggatgagtgatgaatttga
                       ****************** *******************************

A0A060W8P9_BAD-01      cacctggcttgacaaaggggagcccaagagagggattagcccaggagggg
A0A060W8W7_BAD-01      cacctggctcgacaaaggggagcccaagagagggattagcccaggaggag
                       ********* ************************************** *

A0A060W8P9_BAD-01      tcaagcaggaggtctcccgaggatggttctctttcctctggagtccaaac
A0A060W8W7_BAD-01      gcaagcagaaagtctcccgaggatggttctctttcctctggagtccaaag
                        ******* * ************************************** 

A0A060W8P9_BAD-01      gaggccgaaggcagggagtga
A0A060W8W7_BAD-01      gaggcagaaggcagggagtga
                       ***** ***************

© 1998-2021Legal notice