Dataset for CDS classical BH3-containing proteins of organism Nothobranchius furzeri

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1A8AQV0_BAD-01      atggctgcccacttcacga-------------tctcagacagtgactcgg
A0A8C6PNJ4_BMF-01      atggacg--------atgaggaggatgatgtgtttgagccagtctccagc
                       ****  *        * **             * * ** ****  *  * 

A0A1A8AQV0_BAD-01      agccgtcggaagaggtggaggagggagagaagaagcagccgtcagcgggt
A0A8C6PNJ4_BMF-01      tgctggcgcaaaaccttcagg-----gagataaagt------------gt
                        ** * ** ** *  *  ***     ****  ***             **

A0A1A8AQV0_BAD-01      caagaggagagcgttcgcccacaccccaacctgcctga-----gctcagg
A0A8C6PNJ4_BMF-01      gaagaccggggca--cacagacacccggtcctgccctgctaccacacagc
                        ****   * **   * *  ******   ******         * *** 

A0A1A8AQV0_BAD-01      ctcccgttgaatggtcggatc-----aggctcaactcggagtcccacgtt
A0A8C6PNJ4_BMF-01      ggcatgctgccctgtggagtccttcaacactcaac-aggcaacgcaggtt
                         *  * **    ** *  **     *  ******  **   * ** ***

A0A1A8AQV0_BAD-01      tcca---------------acgtctccaga--gatgaggatctcctggcc
A0A8C6PNJ4_BMF-01      ttcgattgcacttccctgcacgctttgagattgttggggattttgaagca
                       * *                ***  *  ***  * ** **** *    ** 

A0A1A8AQV0_BAD-01      agggtggcggaggaggagcctgggacccctacagaggggttcccattcag
A0A8C6PNJ4_BMF-01      a--------gacaacaagacaggga-------agaggag---ccaaacag
                       *        **  *  ** * ****       ***** *   ***  ***

A0A1A8AQV0_BAD-01      agggagatcaaagtctgctcctc-cagccctgtgggccgccaagaagtac
A0A8C6PNJ4_BMF-01      gatggagcggccgcccgccgcacgcagcctggaggtttgca-------tc
                          *        * * **  * * *****  * **   **         *

A0A1A8AQV0_BAD-01      ggccggcagctccgaaggatgagcgacgagttcgacagcctgc-tggaca
A0A8C6PNJ4_BMF-01      ggacagaaactccagctgataggagaccagtttcaccgggaacatttaca
                       ** * * * ****    ***  * *** ****  ** *    * *  ***

A0A1A8AQV0_BAD-01      aagg----ggagatgaggaaggtgagaagtgccgggtcaaccaaacccat
A0A8C6PNJ4_BMF-01      gcagctgtggaggcaagtggcatggaaggtccctgg--------------
                          *    ****   **     **  * ** ** **              

A0A1A8AQV0_BAD-01      gcaccactccaggagctggtggaactacctcttcagtcaccaggagagcg
A0A8C6PNJ4_BMF-01      -----------------------------tctt----------gagtgtt
                                                    ****          *** *  

A0A1A8AQV0_BAD-01      acggagagaacagccaccatgacaaccccacgcagcgcaccgagtag
A0A8C6PNJ4_BMF-01      acactgag----------gtgacaatgt-----------ctgagtag
                       **   ***           ******              * ******

© 1998-2022Legal notice