Dataset for CDS BBC3 of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3HWI8_BBC3-01      atgaaatttggcatggggtctgcccgggcatgtccatgccaggtgcccag
A0A2I3HWI8_BBC3-02      atgaaatttggcatggggtctgcccgggcatgtccatgccaggtgcccag
A0A2I3HWI8_BBC3-03      atgaaatttggcatggggtctgcccgggcatgtccatgccaggtgcccag
                        **************************************************

A0A2I3HWI8_BBC3-01      ggcttcttccgtgacgtgggtcccctgccagatttgt-------------
A0A2I3HWI8_BBC3-02      ggcttcttccgtgacgtgggtcccctgccagatttgtggccccagggagc
A0A2I3HWI8_BBC3-03      ggcttcttccgtgacgtgggtcccctgccagatttgt-------------
                        *************************************             

A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      gccatggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
                                                                          

A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      cctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccct
A0A2I3HWI8_BBC3-03      --------------------------------------------------
                                                                          

A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      cggcagtgtcctgcggcctctgcgagcccggcctagctgccgcccccgcc
A0A2I3HWI8_BBC3-03      --------------------------------------------------
                                                                          

A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      gcccccgccctgctgcccgctgcctacctctgcgcccccaccgctccacc
A0A2I3HWI8_BBC3-03      --------------------------------------------------
                                                                          

A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      cgccgtcaccgccgccctggggggcccccgctggcccgggggtcctcgca
A0A2I3HWI8_BBC3-03      --------------------------------------------------
                                                                          

A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      gccggccccgaggcccgcgcccggacgcaggcggtcccacccaggcggct
A0A2I3HWI8_BBC3-03      --------------------------gcaggcggtcccacccaggcggct
                                                                          

A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      ccgggagtccgcggggaggaggaacagtgggcccgggagatcggggccca
A0A2I3HWI8_BBC3-03      ccgggagtccgcggggaggaggaacagtgggcccgggagatcggggccca
                                                                          

A0A2I3HWI8_BBC3-01      ---------------------------------------------gagac
A0A2I3HWI8_BBC3-02      gctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagac
A0A2I3HWI8_BBC3-03      gctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagac
                                                                     *****

A0A2I3HWI8_BBC3-01      aagaggagcaacagcggcaccgcccctcgccctggagggtcctgtacaat
A0A2I3HWI8_BBC3-02      aagaggagcaacagcggcaccgcccctcgccctggagggtcctgtacaat
A0A2I3HWI8_BBC3-03      aagaggagcaacagcggcaccgcccctcgccctggagggtcctgtacaat
                        **************************************************

A0A2I3HWI8_BBC3-01      ctcatcatgggactcctgcccttacccaggggccacagagcccccgagat
A0A2I3HWI8_BBC3-02      ctcatcatgggactcctgcccttacccaggggccacagagcccccgagat
A0A2I3HWI8_BBC3-03      ctcatcatgggactcctgcccttacccaggggccacagagcccccgagat
                        **************************************************

A0A2I3HWI8_BBC3-01      ggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcggg
A0A2I3HWI8_BBC3-02      ggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcggg
A0A2I3HWI8_BBC3-03      ggagcccaattag-------------------------------------
                        *************                                     

A0A2I3HWI8_BBC3-01      gggcaggcccctcccacctcctgacaccctggccagcgtggggaactttc
A0A2I3HWI8_BBC3-02      gggcaggcccctcccacctcctgacaccctggccagcgtggggaactttc
A0A2I3HWI8_BBC3-03      --------------------------------------------------
                                                                          

A0A2I3HWI8_BBC3-01      tctgcaccatgtag
A0A2I3HWI8_BBC3-02      tctgcaccatgtag
A0A2I3HWI8_BBC3-03      --------------
                                      

© 1998-2020Legal notice