Dataset for CDS classical BH3-containing proteins of organism Neogobius melanostomus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6U3U8_BMF-01      atggaggatgaggag------------------gatgatg----------
A0A8C6U7V6_BAD-03      atgccagccgtacagccacctttaccgtactctcataatgtaaagctcag
A0A8C6U7V6_BAD-01      atg--------gctgcgagcttcaccat-ctctgacagtg----------
A0A8C6U7V6_BAD-02      -------------------------------------ttg----------
                                                             **          

A0A8C6U3U8_BMF-01      -----------tgtttgagcca----------------------------
A0A8C6U7V6_BAD-03      cacgtgtgtccaatatgacccatctgac----------------------
A0A8C6U7V6_BAD-01      -----------aatcggacccgtctgaagacttggacgaggaacagggca
A0A8C6U7V6_BAD-02      -----------aat------------------------------------
                                    *                                    

A0A8C6U3U8_BMF-01      ------gagctgcagtgctggcactccacattcagacagataaagtgtga
A0A8C6U7V6_BAD-03      --------------------------------------------------
A0A8C6U7V6_BAD-01      acagagcaaaggcccagcgcaaactgcagctcaaactgcccgagctccga
A0A8C6U7V6_BAD-02      --------------------------------------------------
                                                                         

A0A8C6U3U8_BMF-01      agaccgggctacgcagacccccggccctgccctggcacccagcaaaggca
A0A8C6U7V6_BAD-03      ------agcgataacaaaac-------------aaatacttgttccttgg
A0A8C6U7V6_BAD-01      ggagcaggcatcggcagaatccggctgagctcagagtcccaagtgtgtgg
A0A8C6U7V6_BAD-02      ------agcatcggcagaatccggctgagctcagagtcccaagtgtgtgg
                              **                             *           

A0A8C6U3U8_BMF-01      tgcttccctttggagtggcagaggagcccagaccactcttttacggcaac
A0A8C6U7V6_BAD-03      ggctacaggccagggctgaagaggagctgggcacccccactgatg-----
A0A8C6U7V6_BAD-01      tg----aggccagggctgaagaggagctgggcacccccactgatg-----
A0A8C6U7V6_BAD-02      tg----aggccagggctgaagaggagctgggcacccccactgatg-----
                        *          * *  * ********   *  * * *  * * *     

A0A8C6U3U8_BMF-01      gcaggttttcgattgcacttcccggcccactttgagcttgttgaagatca
A0A8C6U7V6_BAD-03      ---ggtt--------ccctttccg--------------------------
A0A8C6U7V6_BAD-01      ---ggtt--------ccctttccg--------------------------
A0A8C6U7V6_BAD-02      ---ggtt--------ccctttccg--------------------------
                          ****        * *** ***                          

A0A8C6U3U8_BMF-01      ggaaacaagtggaccactacaagacggagagatgcagaacggggtggacc
A0A8C6U7V6_BAD-03      ----------gggacgctccaag-------------------------tc
A0A8C6U7V6_BAD-01      ----------gggacgctccaag-------------------------tc
A0A8C6U7V6_BAD-02      ----------gggacgctccaag-------------------------tc
                                 **  * ** ****                          *

A0A8C6U3U8_BMF-01      agcctcccaggcagcttcctgctgcacacagtgtggaggcgtgcatcggc
A0A8C6U7V6_BAD-03      agcccccc---cagct-----ctgtgggccgccaagaagta-----cggg
A0A8C6U7V6_BAD-01      agcccccc---cagct-----ctgtgggccgccaagaagta-----cggg
A0A8C6U7V6_BAD-02      agcccccc---cagct-----ctgtgggccgccaagaagta-----cggg
                       **** ***   *****     ***    * *    ** *       *** 

A0A8C6U3U8_BMF-01      cagaagctccagctgatcggagaccagtttcaccgggatcatttacggct
A0A8C6U7V6_BAD-03      cggcagctgcggcgcatgagcgacgagtt----cgacagcat-----gct
A0A8C6U7V6_BAD-01      cggcagctgcggcgcatgagcgacgagtt----cgacagcat-----gct
A0A8C6U7V6_BAD-02      cggcagctgcggcgcatgagcgacgagtt----cgacagcat-----gct
                       * * **** * **  **  * *** ****    **  * ***     ***

A0A8C6U3U8_BMF-01      gtatcaacg------------------acaccaaagg---aaccagggcc
A0A8C6U7V6_BAD-03      ggacaaagg------------------gaacagcaggcccatccagcact
A0A8C6U7V6_BAD-01      ggacaaaggggaaatgaagaagatgaagaacagcaggcccatccagcact
A0A8C6U7V6_BAD-02      ggacaaagg------------------gaacagcaggcccatccagcact
                       * *  ** *                    **   ***   * ****  * 

A0A8C6U3U8_BMF-01      ctgtg---tggtggcgcctggccgcagccctgctcagtctgctgttggac
A0A8C6U7V6_BAD-03      ccaagacctggtggagct---------acttgttcag-ccaccaggaaac
A0A8C6U7V6_BAD-01      ccaagacctggtggagct---------acttgttcag-ccaccaggaaac
A0A8C6U7V6_BAD-02      ccaagacctggtggagct---------acttgttcag-ccaccaggaaac
                       *   *   ****** **           * ** **** *  *      **

A0A8C6U3U8_BMF-01      cggggggg-----cttcatggctggaggggggcgaggggcagcgggacag
A0A8C6U7V6_BAD-03      agagggagagaaccaccacgact---------cacagcgcaccg------
A0A8C6U7V6_BAD-01      agagggagagaaccaccacgact---------cacagcgcaccg------
A0A8C6U7V6_BAD-02      agagggagagaaccaccacgact---------cacagcgcaccg------
                        * *** *     *  ** * **         *   * *** **      

A0A8C6U3U8_BMF-01      aggtga
A0A8C6U7V6_BAD-03      -agtag
A0A8C6U7V6_BAD-01      -agtag
A0A8C6U7V6_BAD-02      -agtag
                         **  

© 1998-2022Legal notice