Dataset for CDS BCL2L11 of organism Nannospalax galili

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6QXX9_BCL2L11      atggccaagcaaccttccgatgtaagttctgagtgtgacagagagggtgg
A0A8C6QXX9_BCL2L11      atggccaagcaaccttccgatgtaagttctgagtgtgacagagagggtgg
A0A8C6QXX9_BCL2L11      atggccaagcaaccttccgatgtaagttctgagtgtgacagagagggtgg
                        **************************************************

A0A8C6QXX9_BCL2L11      acaattgcagcctgctgagaggcctgcccagctcaggcctggggcaccta
A0A8C6QXX9_BCL2L11      acaattgcagcctgctgagaggcctgcccagctcaggcctggggcaccta
A0A8C6QXX9_BCL2L11      acaattgcagcctgctgagaggcctgcccagctcaggcctggggcaccta
                        **************************************************

A0A8C6QXX9_BCL2L11      cctccctccagacagaacagcaaggtaatcccgaaggcgaaggggaccgc
A0A8C6QXX9_BCL2L11      cctccctccagacagaacagca----------------------------
A0A8C6QXX9_BCL2L11      cctccctccagacagaacagca----------------------------
                        **********************                            

A0A8C6QXX9_BCL2L11      tgcccccacggcagccctcagggcccgctggccccaccggccagccctgg
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
                                                                          

A0A8C6QXX9_BCL2L11      gccttttgctaccagatccccgcttttcatctttgtgagaagatcttctc
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
                                                                          

A0A8C6QXX9_BCL2L11      tgctgtcccgatcctccagtgggtatttctcttttgacacagacaggagc
A0A8C6QXX9_BCL2L11      ----------------------------------------agacaggagc
A0A8C6QXX9_BCL2L11      ----------------------------------------agacaggagc
                                                                **********

A0A8C6QXX9_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A8C6QXX9_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A8C6QXX9_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
                        **************************************************

A0A8C6QXX9_BCL2L11      ccaggccttcaaccattatctcagtgcgatggcttctataaggcagtctc
A0A8C6QXX9_BCL2L11      ccaggccttcaaccattatctcagtgcgatggcttctataaggcagtctc
A0A8C6QXX9_BCL2L11      ccaggccttcaaccattatctcagtgcgatgg------------------
                        ********************************                  

A0A8C6QXX9_BCL2L11      aggaggaacctgcagatatacgccccgaaatatggattgcacaggagctg
A0A8C6QXX9_BCL2L11      aggaggaacctgcagatatacgccccgaaatatggattgcacaggagctg
A0A8C6QXX9_BCL2L11      -------------agctaaa-------aaacttgaatc--------tctg
                                     ** ** *       ***  ** **          ***

A0A8C6QXX9_BCL2L11      cggcggattggagatgaatttaacgcctcttacccaaggagggtattttt
A0A8C6QXX9_BCL2L11      cggcggattggagatgaatttaacgcctcttacccaaggagggtattttt
A0A8C6QXX9_BCL2L11      cagc------------------------ctt---caag----------ct
                        * **                        ***   ****           *

A0A8C6QXX9_BCL2L11      gaataattaccaagcagatgaagaccacccccaaatggttatcttacaac
A0A8C6QXX9_BCL2L11      gaataattaccaagcagatgaagaccacccccaaatggttatcttacaac
A0A8C6QXX9_BCL2L11      aaataa--------------------------------------------
                         *****                                            

A0A8C6QXX9_BCL2L11      tgttacgtttcatcgtccgcctggtgtggagaaggcattga
A0A8C6QXX9_BCL2L11      tgttacgtttcatcgtccgcctggtgtggagaaggcattga
A0A8C6QXX9_BCL2L11      -----------------------------------------
                                                                 

© 1998-2022Legal notice