Dataset for CDS classical BH3-containing proteins of organism Mustela putorius furo

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M3YAD5_BMF-01          -atggagccgcctcagtgtgtggaggagctggaggatgacgtgttccagc
M3Y0R3_BBC3-01         cagg------ccccagggagcgccatggcccgagcacgcc----------
M3YDI3_BCL2L11-01      -atg------ttcccggcggcg--gcggccggggcagcgc----------
M3YNE7_BAD-01          -atg------ttccagatccca--g-agtttgagcccagt----------
                        * *         * *           *   * *                

M3YAD5_BMF-01          cagaggatggggagccggggacccagcct---gggagcttgctctctgct
M3Y0R3_BBC3-01         ----aggagggcagctccc--cggagcccgtagagggcctgtcccgcgac
M3YDI3_BCL2L11-01      ----gggccaga-------ggcgcggcgcgcggagccct----------c
M3YNE7_BAD-01          ----gagcaggaagactccagccctgcagataggggcct----------g
                                 *          *   **     * *  *            

M3YAD5_BMF-01          gacctgt-----ttgcccagagccagctggactgcc--ctcttagccg--
M3Y0R3_BBC3-01         ggcccgcgcccctttcccctcagccgcctggtgccc-----tcggccgtg
M3YDI3_BCL2L11-01      ggctgccggacggctcgcggcggcgggcgggctgccag----tggccggc
M3YNE7_BAD-01          ggccccag-------ccccacaggggatcaacccccaggccttggcaagc
                       * *            * *       *        **        **    

M3YAD5_BMF-01          -tctgcatctcttcc-----ctctca--------cccactgctgtggccc
M3Y0R3_BBC3-01         tcctgt---ggcctctgggaatctgactgc-agtccccgagttgcagccc
M3YDI3_BCL2L11-01      -tctgc-gctgccccgggggctctgaaggcgagtcccaggctttgtctcc
M3YNE7_BAD-01          acctgcagacggccccaggcctcctaggggaag--------ctggtcacc
                         ***         *      **  *                *     **

M3YAD5_BMF-01          tgggcttcgacccaccagccaggaggacaaggccacccag--------ac
M3Y0R3_BBC3-01         acggccttttccgggccg--gggcagcagctgtttcccagcccccacctc
M3YDI3_BCL2L11-01      cgcgcttctttcgtgctgagggtca--------------g-----ggagc
M3YNE7_BAD-01          agca-------ggggcagccggccagcagcagccaccatg-----gaggc
                                      * *   *                 *         *

M3YAD5_BMF-01          cctcagtc----------------cagcctc-------cccgagtcaggg
M3Y0R3_BBC3-01         ccccagtct---------------gggtctc-------cttaacctccca
M3YDI3_BCL2L11-01      tccgggtcggcgaaggacgcgagcgggacgccgcggggctcgggcccgga
M3YNE7_BAD-01          gctggggctgtgga-gacgcg---gagtcgccac--agctcgtaccccgc
                        *   * *                  * * *       *           

M3YAD5_BMF-01          tgtcatgctgccttgtggggtgaccgaagaaccccagcgact--------
M3Y0R3_BBC3-01         gaggacgatagttggagggagtgtgggcagagcgagaggact--------
M3YDI3_BCL2L11-01      cgcgacggtcggaagggaaggggcggacaaaa---aaagaccaaatggca
M3YNE7_BAD-01          ggggaccgaggaagatgaggggatggaggaag---aagagct--------
                           *           *        *    *         *         

M3YAD5_BMF-01          -------ctt----------ttatggcaacgctggcta------------
M3Y0R3_BBC3-01         -----gcttt----------tcccagg-----------------------
M3YDI3_BCL2L11-01      aagcaaccttcagatgtaagttctgagtgtgaccgagaaggtggacaatt
M3YNE7_BAD-01          ---tagccct----------ttccgggggcgctcgcgg------------
                                *          *                             

M3YAD5_BMF-01          ---------------------ccggc--------------tccctctccc
M3Y0R3_BBC3-01         ------------------tcctcagc------------cctcactctcgc
M3YDI3_BCL2L11-01      gcagcctgttgagaggcctcctcagctcaggcctggggcccctacctctc
M3YNE7_BAD-01          ---------------------tcagc----gcc-----ccccaacctctg
                                             * **               *   ***  

M3YAD5_BMF-01          tgccagcttccctgca---------------ggcttgcctctcggggacc
M3Y0R3_BBC3-01         c---ggcggagccgcacctggaatcgccggtgcccagtgccccgggggcc
M3YDI3_BCL2L11-01      tacagacagagcagca--------agacaggagcccggcacccatgagtt
M3YNE7_BAD-01          t----gcggcactgcg--------ttacgg-----------ccgcgagct
                             *    * **                           *  *    

M3YAD5_BMF-01          ------------------------agccccctg-----------------
M3Y0R3_BBC3-01         ctggcgggcggcc-ccacccaggcagccccgggagtccggggggagg---
M3YDI3_BCL2L11-01      gtgacaaatcaac-aca-------aaccccaagtcctccttgccaggcct
M3YNE7_BAD-01          ccggaggatgagcgacg-------agttccagggct-----------cct
                                               *   **  *                 

M3YAD5_BMF-01          -------------aagggcagtggcagca---------------------
M3Y0R3_BBC3-01         -------------aggagcagtgggcccgggagatcggggcccagctgcg
M3YDI3_BCL2L11-01      tcaaccattatctcagtgcaatggcttccaggaggcagtctcaggctgta
M3YNE7_BAD-01          tca----------------aggggcttcc---------------------
                                          *  **   *                      

M3YAD5_BMF-01          -----------tcgagcagaggtacagattgcccgaaagcttcagtgcat
M3Y0R3_BBC3-01         gaggatggcggacgacctcaac--------gcgctgtacgagcggcggag
M3YDI3_BCL2L11-01      cctgcagatatgcgcccggagatgtggattgcgcaggagttgcggcgtat
M3YNE7_BAD-01          -----------tcgcccgaaga--------gcgcaggcacagccacgcag
                                   **  *  *          ** *        *   * * 

M3YAD5_BMF-01          tgcagac-------cagttccatcgacttcacatgcagcaacaccagcaa
M3Y0R3_BBC3-01         acaaga-agagcagcagcgacaccgcccctccccctggagggtcctgtac
M3YDI3_BCL2L11-01      tggagacg-------agtttaatgcgtattacccaaggagggtctttttg
M3YNE7_BAD-01          atgcgacagagccccagttggacgcgcgtcatcca-----gtcctggtgg
                           **         **    *                     *      

M3YAD5_BMF-01          aacca--------------------aaatcgggtgtggtgg---------
M3Y0R3_BBC3-01         aatctcatcatgggactcctgcccttacccaggggccgtgg-----agcc
M3YDI3_BCL2L11-01      aataa-------------------ttacccagcagccgaag--cccaccc
M3YNE7_BAD-01          gatcg-------------------gaacttggggagaggaggctccgccc
                        *                        *    *     *  *         

M3YAD5_BMF-01          -cagatccttctcttcctacacaaccttgctttgaacgcagacgagaaca
M3Y0R3_BBC3-01         ccaga---------------------------------------------
M3YDI3_BCL2L11-01      ccaaatgattatcttacgac-----------tgttacgttacatcatccg
M3YNE7_BAD-01          cc------------------------------------------------

M3YAD5_BMF-01          ggaatggggcgggtcccaggtga
M3Y0R3_BBC3-01         -------gatggagcccaattag
M3YDI3_BCL2L11-01      cctggtgtggagattacagtga-
M3YNE7_BAD-01          -------------tcccaatga-

© 1998-2022Legal notice