Dataset for CDS BMF of organism Mus spicilegus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6GZK8_BMF-01      atgcccggagcgggcgtattttggaaacaataccgcgcggtgtgccttgg
A0A8C6GZK8_BMF-02      --------------------------------------------------
A0A8C6GZK8_BMF-03      --------------------------------------------------
                                                                         

A0A8C6GZK8_BMF-01      cctcctcccgcgccagctcgcgcctgcagccttcgctgccgcagcccgcg
A0A8C6GZK8_BMF-02      --------------------------------------------------
A0A8C6GZK8_BMF-03      --------------------------------------------------
                                                                         

A0A8C6GZK8_BMF-01      ccaccgcctcccaccgcagcccgctggagtttgcccccttcttcccaatc
A0A8C6GZK8_BMF-02      --------------------------------------------------
A0A8C6GZK8_BMF-03      --------------------------------------------------
                                                                         

A0A8C6GZK8_BMF-01      gagtgtgggcaccaagccccccgagtgttcttcaccctggaccctggcgc
A0A8C6GZK8_BMF-02      --------------------------------------------------
A0A8C6GZK8_BMF-03      --------------------------------------------------
                                                                         

A0A8C6GZK8_BMF-01      agagccctggcatcacaactcggaggctgagacgctgtcctggagtcacc
A0A8C6GZK8_BMF-02      --------------------------------------------------
A0A8C6GZK8_BMF-03      --------------------------------------------------
                                                                         

A0A8C6GZK8_BMF-01      caggagagatggagccacctcagtgtgtggaggagctagaagatgatgtg
A0A8C6GZK8_BMF-02      --------atggagccacctcagtgtgtggaggagctagaagatgatgtg
A0A8C6GZK8_BMF-03      --------atggagccacctcagtgtgtggaggagctagaagatgatgtg
                               ******************************************

A0A8C6GZK8_BMF-01      ttccagtcagaggatggggagccagggacacagcctgggggcttgctctc
A0A8C6GZK8_BMF-02      ttccagtcagaggatggggagccagggacacagcctgggggcttgctctc
A0A8C6GZK8_BMF-03      ttccagtcagaggatggggagccagggacacagcctgggggcttgctctc
                       **************************************************

A0A8C6GZK8_BMF-01      tgctgacctgtttgcccagagccagctggactgtcccctcagtcggctcc
A0A8C6GZK8_BMF-02      tgctgacctgtttgcccagagccagctggactgtcccctcagtcggctcc
A0A8C6GZK8_BMF-03      tgctgacctgtttgcccagagccagctggactgtcccctcagtcggctcc
                       **************************************************

A0A8C6GZK8_BMF-01      agctcttccctctcacccactgctgtggtcccggactccggcccataagc
A0A8C6GZK8_BMF-02      agctcttccctctcacccactgctgtggtcccggactccggcccataagc
A0A8C6GZK8_BMF-03      agctcttccctctcacccactgctgtggtcccggactccggcccataagc
                       **************************************************

A0A8C6GZK8_BMF-01      caggaagacaaggccactcagaccctcagtccagcttccccaagccaggg
A0A8C6GZK8_BMF-02      caggaagacaaggccactcagaccctcagtccagcttccccaagccaggg
A0A8C6GZK8_BMF-03      caggaagacaaggccactcagaccctcagtccagcttccccaagccaggg
                       **************************************************

A0A8C6GZK8_BMF-01      tgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacg
A0A8C6GZK8_BMF-02      tgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacg
A0A8C6GZK8_BMF-03      tgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacg
                       **************************************************

A0A8C6GZK8_BMF-01      gcaacgctggctacaggcttcctctccctgccagtttccctgcaggctca
A0A8C6GZK8_BMF-02      gcaacgctggctacaggcttcctctccctgccagtttccctgcaggctca
A0A8C6GZK8_BMF-03      gcaacgctggctacaggcttcctctccctgccagtttccctgcaggctca
                       **************************************************

A0A8C6GZK8_BMF-01      ccccttggggagcagccccctgaaggacagttccttcagcaccgagcaga
A0A8C6GZK8_BMF-02      ccccttggggagcagccccctgaaggacagttccttcagcaccgagcaga
A0A8C6GZK8_BMF-03      ccccttggggagcagccccctgaaggacagttccttcagcaccgagcaga
                       **************************************************

A0A8C6GZK8_BMF-01      ggtgcagatcgccagaaagcttcagtgtattgcagaccagttccatcggc
A0A8C6GZK8_BMF-02      ggtgcagatcgccagaaagcttcagtgtattgcagaccagttccatcggc
A0A8C6GZK8_BMF-03      ggtgcagatcgccagaaagcttcagtgtattgcagaccagttccatcggc
                       **************************************************

A0A8C6GZK8_BMF-01      ttcatacgcaacaacaccagcagaaccgagaccgtgcgtggtggcaggtc
A0A8C6GZK8_BMF-02      ttcatacgcaacaacaccagcagaaccgagaccgtgcgtggtggcaggtc
A0A8C6GZK8_BMF-03      ttcatacgcaacaacaccagcagaaccgagaccgtgcgtggtggcaggtc
                       **************************************************

A0A8C6GZK8_BMF-01      ttcctcttccttcaaaacctcgccctgaacagacaagaaaacagggaagg
A0A8C6GZK8_BMF-02      ttcctcttccttcaaaacctcgccctgaacagacaagaaaacagggaagg
A0A8C6GZK8_BMF-03      ttcctcttccttcaaaacctcgccctgaacagacaagaaaacagggaagg
                       **************************************************

A0A8C6GZK8_BMF-01      ggtggggccctggtga
A0A8C6GZK8_BMF-02      ggtggggccctggtga
A0A8C6GZK8_BMF-03      ggtggggccctggtga
                       ****************

© 1998-2022Legal notice