Dataset for CDS BCL2L11 of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

O54918_BCL2L11-03      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg
O54918_BCL2L11-01      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg
O54918_BCL2L11-05      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg
O54918_BCL2L11-06      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg
O54918_BCL2L11-08      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg

O54918_BCL2L11-03      acaattgcagcctgctgagaggcctccccagctcaggcctggggccccta
O54918_BCL2L11-01      acaattgcagcctgctgagaggcctccccagctcaggcctggggccccta
O54918_BCL2L11-05      acaattgcagcctgctgagaggcctccccagctcaggcctggggccccta
O54918_BCL2L11-06      acaattgcagcctgctgagaggcctccccagctcaggcctggggccccta
O54918_BCL2L11-08      acaattgcagcctgctgagaggcctccccagctcaggcctggggccccta

O54918_BCL2L11-03      cctccctacagacagaaccgca----------------------------
O54918_BCL2L11-01      cctccctacagacagaaccgcaaggtaatcccgacggcgaaggggaccgc
O54918_BCL2L11-05      cctccctacagacagaaccgca----------------------------
O54918_BCL2L11-06      cctccctacagacagaaccgca----------------------------
O54918_BCL2L11-08      cctccctacagacagaaccgca----------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      tgcccccacggcagccctcagggcccgctggccccaccggccagccctgg
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------

O54918_BCL2L11-03      --------------------------------------------------
O54918_BCL2L11-01      cccttttgctaccagatccccacttttcatctttgtgagaagatcttctc
O54918_BCL2L11-05      --------------------------------------------------
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------

O54918_BCL2L11-03      ----------------------------------------agacaggagc
O54918_BCL2L11-01      tgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagc
O54918_BCL2L11-05      ----------------------------------------agacaggagc
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------

O54918_BCL2L11-03      ccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttg
O54918_BCL2L11-01      ccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttg
O54918_BCL2L11-05      ccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttg
O54918_BCL2L11-06      --------------------------------------------------
O54918_BCL2L11-08      --------------------------------------------------

O54918_BCL2L11-03      ccaggccttcaaccacta----------------------------tctc
O54918_BCL2L11-01      ccaggccttcaaccactatctcagtgcaatggcttccatacgacagtctc
O54918_BCL2L11-05      ccaggccttcaaccactatctcagtgcaatggcttccatacgacagtctc
O54918_BCL2L11-06      ------------------------------agcttccatacgacagtctc
O54918_BCL2L11-08      ------------------------------agcttccatacgacagtctc

O54918_BCL2L11-03      ag----------------------------------------------tg
O54918_BCL2L11-01      aggaggaacctgaagatctgcgcccggagatacggattgcacaggagctg
O54918_BCL2L11-05      aggaggaacctgaagatctgcgcccggagatacggattgcacaggagctg
O54918_BCL2L11-06      aggaggaacctgaagatctgcgcccggagatacggattgcacaggagctg
O54918_BCL2L11-08      aggaggaacctgaagatctgcgcccggagatacggattgcacaggagctg
                       **                                              **

O54918_BCL2L11-03      caatggatcag--------ttggagaatcttaaccaag--------tggc
O54918_BCL2L11-01      cggcggatcggagacgagttcaacgaaacttacacaaggagggtgtttgc
O54918_BCL2L11-05      cggcggatcggagacgagttcaacgaaacttacacaaggagggtgtttgc
O54918_BCL2L11-06      cggcggatcggagacgagttcaacgaaacttacacaaggagggtgtttgc
O54918_BCL2L11-08      cggcggatcggagacgagttcaacgaaacttacacaaggagggtgtttgc
                       *   ***** *        *    *** ****  ****        * **

O54918_BCL2L11-03      acaaaatatccacggtgat-------------------------------
O54918_BCL2L11-01      aaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaac
O54918_BCL2L11-05      aaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaac
O54918_BCL2L11-06      aaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaac
O54918_BCL2L11-08      aaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaac
                       * *  **  ** **  * *                               

O54918_BCL2L11-03      ------------------gcctggtaca--------actga
O54918_BCL2L11-01      tgttacgctttatcttccgtctggtatggagaaggcattga
O54918_BCL2L11-05      tgttacgctttatcttccgtctggtatggagaaggcattga
O54918_BCL2L11-06      tgttacgctttatcttccgtctggtatggagaaggcattga
O54918_BCL2L11-08      tgttacgctttatcttccgtctggtatggagaaggcattga
                                         * ******          * ***

© 1998-2020Legal notice