Dataset for CDS BCL2L11 of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O54918_BCL2L11-01      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg
O54918_BCL2L11-03      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg
                       **************************************************

O54918_BCL2L11-01      acaattgcagcctgctgagaggcctccccagctcaggcctggggccccta
O54918_BCL2L11-03      acaattgcagcctgctgagaggcctccccagctcaggcctggggccccta
                       **************************************************

O54918_BCL2L11-01      cctccctacagacagaaccgcaaggtaatcccgacggcgaaggggaccgc
O54918_BCL2L11-03      cctccctacagacagaaccgca----------------------------
                       **********************                            

O54918_BCL2L11-01      tgcccccacggcagccctcagggcccgctggccccaccggccagccctgg
O54918_BCL2L11-03      --------------------------------------------------
                                                                         

O54918_BCL2L11-01      cccttttgctaccagatccccacttttcatctttgtgagaagatcttctc
O54918_BCL2L11-03      --------------------------------------------------
                                                                         

O54918_BCL2L11-01      tgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagc
O54918_BCL2L11-03      ----------------------------------------agacaggagc
                                                               **********

O54918_BCL2L11-01      ccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttg
O54918_BCL2L11-03      ccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttg
                       **************************************************

O54918_BCL2L11-01      ccaggccttcaaccactatctcagtgcaatggcttccatacgacagtctc
O54918_BCL2L11-03      ccaggccttcaaccactatctcagtgcaatggat---------cagt---
                       ******************************** *         ****   

O54918_BCL2L11-01      aggaggaacctgaagatctgcgcccggagatacggattgcacaggagctg
O54918_BCL2L11-03      --------------------------------------------------
                                                                         

O54918_BCL2L11-01      cggcggatcggagacgagttcaacgaaacttacacaaggagggtgtttgc
O54918_BCL2L11-03      tggagaatcttaaccaagtggcacaaaatatccacggtga----------
                        ** * ***  *  * ***   ** ***  * ***   **          

O54918_BCL2L11-01      aaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaac
O54918_BCL2L11-03      --------------------------------------------------
                                                                         

O54918_BCL2L11-01      tgttacgctttatcttccgtctggtatggagaaggcattga
O54918_BCL2L11-03      -----------------tgcctggtaca--------actga
                                         * ******          * ***

© 1998-2020Legal notice