Dataset for CDS BAD of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q61337_BAD-01      atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtcc
Q61337_BAD-05      ------------------------------------------------------------
                                                                               

Q61337_BAD-01      gatcccggaatccggagcctggggagcgacgcgggaggaaggcggtggagaccagcagcc
Q61337_BAD-05      ------------------------------------------------------------
                                                                               

Q61337_BAD-01      cagagtatgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctaca
Q61337_BAD-05      ------atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctaca
                         ******************************************************

Q61337_BAD-01      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
Q61337_BAD-05      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
                   ************************************************************

Q61337_BAD-01      ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggc
Q61337_BAD-05      ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggc
                   ************************************************************

Q61337_BAD-01      gcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggat
Q61337_BAD-05      gcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggat
                   ************************************************************

Q61337_BAD-01      gaagggatggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaat
Q61337_BAD-05      gaagggatggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaat
                   ************************************************************

Q61337_BAD-01      ctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
Q61337_BAD-05      ctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
                   ************************************************************

Q61337_BAD-01      tccttcaagggacttcctcgcccaaagagcgcaggcactgcaacacagatgcgacaaagc
Q61337_BAD-05      tccttcaaggt---------------gagcgccagcgtt-------aggtgcga------
                   **********                ******  **  *       ** *****      

Q61337_BAD-01      gccggctggacgcgcattatccagtcctggtgggatcgaaacttgggcaaaggaggctcc
Q61337_BAD-05      ------------------------------tgggacc-----------------------
                                                 ***** *                       

Q61337_BAD-01      accccctcccagtga
Q61337_BAD-05      ------------tga
                               ***

© 1998-2020Legal notice