Dataset for CDS BAD of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q61337_BAD-09      ------------------------------------------------------------
Q61337_BAD-07      ------------------------------------------------------------
Q61337_BAD-02      atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtcc
Q61337_BAD-05      ------------------------------------------------------------
Q61337_BAD-01      atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtcc
Q61337_BAD-03      ------------------------------------------------------------
Q61337_BAD-04      ------------------------------------------------------------
Q61337_BAD-06      ------------------------------------------------------------
                                                                               

Q61337_BAD-09      ------------------------------------------------------------
Q61337_BAD-07      ------------------------------------------------------------
Q61337_BAD-02      gatcccggaatccggagcctggggagcgacgcgggaggaaggcggtggagaccagcagcc
Q61337_BAD-05      ------------------------------------------------------------
Q61337_BAD-01      gatcccggaatccggagcctggggagcgacgcgggaggaaggcggtggagaccagcagcc
Q61337_BAD-03      ------------------------------------------------------------
Q61337_BAD-04      ------------------------------------------------------------
Q61337_BAD-06      ------------------------------------------------------------
                                                                               

Q61337_BAD-09      ------------------------------------------------------------
Q61337_BAD-07      ----------tccagatcccagagtttgagccgagtgagcaggaagacgctagtgctaca
Q61337_BAD-02      cagagtatgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctaca
Q61337_BAD-05      ------atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctaca
Q61337_BAD-01      cagagtatgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctaca
Q61337_BAD-03      ------atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctaca
Q61337_BAD-04      ------atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctaca
Q61337_BAD-06      ------atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctaca
                                                                               

Q61337_BAD-09      ------------------------------------------------------------
Q61337_BAD-07      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
Q61337_BAD-02      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
Q61337_BAD-05      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
Q61337_BAD-01      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
Q61337_BAD-03      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
Q61337_BAD-04      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
Q61337_BAD-06      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
                                                                               

Q61337_BAD-09      ------------------------------------------------------------
Q61337_BAD-07      ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggc
Q61337_BAD-02      ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggc
Q61337_BAD-05      ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggc
Q61337_BAD-01      ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggc
Q61337_BAD-03      ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggc
Q61337_BAD-04      ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggc
Q61337_BAD-06      ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggc
                                                                               

Q61337_BAD-09      ------------------------------------------------------------
Q61337_BAD-07      gcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggat
Q61337_BAD-02      gcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggat
Q61337_BAD-05      gcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggat
Q61337_BAD-01      gcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggat
Q61337_BAD-03      gcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggat
Q61337_BAD-04      gcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggat
Q61337_BAD-06      gcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggat
                                                                               

Q61337_BAD-09      ------------------------------------------------------------
Q61337_BAD-07      gaagggatggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaat
Q61337_BAD-02      gaagggatggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaat
Q61337_BAD-05      gaagggatggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaat
Q61337_BAD-01      gaagggatggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaat
Q61337_BAD-03      gaagggatggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaat
Q61337_BAD-04      gaagggatggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaat
Q61337_BAD-06      gaagggatggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaat
                                                                               

Q61337_BAD-09      -----ggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
Q61337_BAD-07      ctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
Q61337_BAD-02      ctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
Q61337_BAD-05      ctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
Q61337_BAD-01      ctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
Q61337_BAD-03      ctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
Q61337_BAD-04      ctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
Q61337_BAD-06      ctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
                        *******************************************************

Q61337_BAD-09      tccttcaagtttcattt--------aggatcccggcacacgcatcatcccgtgtc-----
Q61337_BAD-07      tccttcaag----------------agcatgctgggacttgcagtt-ctaatccg-----
Q61337_BAD-02      tccttcaaggga-----------gaagagctgacgtac----------------------
Q61337_BAD-05      tccttcaaggt---------------gagcgccagcgt-t--------aggtgcga----
Q61337_BAD-01      tccttcaagggacttcctcgcccaaagagcgcaggcac-tgcaaca-cagatgcgacaaa
Q61337_BAD-03      tccttcaagggacttcctcgcccaaagagcgcaggcac-tgcaaca-cagatgcgacaaa
Q61337_BAD-04      tccttcaagggacttcctcgcccaaagagcgcaggcac-tgcaaca-cagatgcgacaaa
Q61337_BAD-06      tccttcaagggacttcctcgcccaaagagcgcaggcac-tgcaaca-cagatgcgacaaa
                   *********                 *       *                         

Q61337_BAD-09      ------tctgaccgcccagtgcagagcaagctggtggt----------------------
Q61337_BAD-07      --------tcctctctcagtgtccagtgatttgctgggatttcctccctcttcctccttt
Q61337_BAD-02      ------------------------------------------------------------
Q61337_BAD-05      ----------------------------------tgggac--------------------
Q61337_BAD-01      gcgccggctggacgcgcattatccagt--cctggtgggat--------------------
Q61337_BAD-03      gcgccggctggacgcgcattatccagt--cctggtgggat--------------------
Q61337_BAD-04      gcgccggctggacgcgcattatccagt--cctggtgggat--------------------
Q61337_BAD-06      gcgccggctggacgcgcattatccagt--cctggtgggat--------------------
                                                                               

Q61337_BAD-09      ---ggggacctgattcgggatgccagaatgaggctcactctttcctcctccttccctga-
Q61337_BAD-07      gtccaagaccccgtccccagtcccgg--------------tttatgccttcacctgtaa-
Q61337_BAD-02      ------------------------ag--------------cttgagtcccttccggtgcg
Q61337_BAD-05      ---c----------------------------------------------------tga-
Q61337_BAD-01      ---cgaaacttgggcaaagg---agg--------------ctccaccccctcccagtga-
Q61337_BAD-03      ---cgaaacttgggcaaagg---agg--------------ctccaccccctcccagtga-
Q61337_BAD-04      ---cgaaacttgggcaaagg---agg--------------ctccaccccctcccagtga-
Q61337_BAD-06      ---cgaaacttgggcaaagg---agg--------------ctccaccccctcccagtga-
                                                                           *   

Q61337_BAD-09      --------
Q61337_BAD-07      --------
Q61337_BAD-02      tgcaatag
Q61337_BAD-05      --------
Q61337_BAD-01      --------
Q61337_BAD-03      --------
Q61337_BAD-04      --------
Q61337_BAD-06      --------
                           

© 1998-2022Legal notice