Dataset for CDS PMAIP1 of organism Moschus moschiferus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6ECQ4_PMAIP1-      atgcctggaagaagggctcgtagaagcgcccagccgagccccacgcgggt
A0A8C6CNS6_PMAIP1-      atgcctggaaggagggctcgcaggagcgcccagctgagccccgcgcgggt
A0A8C6D4Q6_PMAIP1-      atgcctggaaggagggctcgcaggagcgcccagccgagccccgcgcggga
A0A8C6FY79_PMAIP1-      atgcctggaaggaggtctcgcaggagtgcccagccgagccccgcgcgggt
                        *********** *** **** ** ** ******* ******* ****** 

A0A8C6ECQ4_PMAIP1-      cccggcagatcctgaagttgagtgcgccattcagtggaggagaattggag
A0A8C6CNS6_PMAIP1-      cccggcagatcctgaagttgagtgtgccattcagttgaggagaattggag
A0A8C6D4Q6_PMAIP1-      tcaacgagatcctgaagttgagtgtgccattcagttgaggagaattggag
A0A8C6FY79_PMAIP1-      cgcggcagatcctgaagttgagtgtgctattcagttgaggagaattggag
                              ****************** ** ******* **************

A0A8C6ECQ4_PMAIP1-      acaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctc
A0A8C6CNS6_PMAIP1-      acaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctc
A0A8C6D4Q6_PMAIP1-      acaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctc
A0A8C6FY79_PMAIP1-      acaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctc
                        **************************************************

A0A8C6ECQ4_PMAIP1-      cgctcaggcacttga
A0A8C6CNS6_PMAIP1-      cgctcaggaacttga
A0A8C6D4Q6_PMAIP1-      cgctcaggaacttga
A0A8C6FY79_PMAIP1-      cgctcaggaacttaa
                        ******** **** *

© 1998-2022Legal notice