Dataset for CDS BBC3 of organism Moschus moschiferus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6CSS1_BBC3-01      gt----------------------------------------gagagcca
A0A8C6CSS1_BBC3-02      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcct
                         *                                        *** *** 

A0A8C6CSS1_BBC3-01      cggcagaggctgcccgggc-------------------------------
A0A8C6CSS1_BBC3-02      ggcccgcgacggcccgcgccccttcccgctcagccgcctggtgccctcgg
                         * * * * * ***** **                               

A0A8C6CSS1_BBC3-01      --atgtccg---------------------tgccagctgccccgg-----
A0A8C6CSS1_BBC3-02      cggtgtcctgcggcctctgcgaacccggcctgcctgctgcccccgccgcc
                           *****                      **** ******** *     

A0A8C6CSS1_BBC3-01      ------------------gctttcttct----------------------
A0A8C6CSS1_BBC3-02      cccgccctgctgcccgccgcctacctctgcgcccctaccaccccgcccgc
                                          ** * * ***                      

A0A8C6CSS1_BBC3-01      -----------ccctctgggtcccccacc---------------------
A0A8C6CSS1_BBC3-02      cgtcaccgccgccctgggggccccccgctggcctgggggtccccgcagcc
                                   ****  *** ***** *                      

A0A8C6CSS1_BBC3-01      -------agattcg--------tggtcctcagccttcactctcgcccgcg
A0A8C6CSS1_BBC3-02      ggccccgaggtccgcgacccgacggtcctcagccttcactctcgcccgcg
                               ** * **         ***************************

A0A8C6CSS1_BBC3-01      gagcagcacctggaatcgccagtgcccagcgctccgggggccctggcggg
A0A8C6CSS1_BBC3-02      gagcagcacctggaatcgccagtgcccagcgctccgggggccctggcggg
                        **************************************************

A0A8C6CSS1_BBC3-01      cggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
A0A8C6CSS1_BBC3-02      cggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
                        **************************************************

A0A8C6CSS1_BBC3-01      cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcg
A0A8C6CSS1_BBC3-02      cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcg
                        **************************************************

A0A8C6CSS1_BBC3-01      ctgtacgagcggcggagacaagaggagcaacagcgacaccgcccctcgcc
A0A8C6CSS1_BBC3-02      ctgtacgagcggcggagacaagaggagcaacagcgacaccgcccctcgcc
                        **************************************************

A0A8C6CSS1_BBC3-01      ctggagggtcctgtacaatctcatcatgggactcctgcccttccccgggg
A0A8C6CSS1_BBC3-02      ctggagggtcctgtacaatctcatcatgggactcctgcccttccccgggg
                        **************************************************

A0A8C6CSS1_BBC3-01      gccgtggagcccccgaggtggagcccaattag
A0A8C6CSS1_BBC3-02      gccgtggagcccccgaggtggagcccaattag
                        ********************************

© 1998-2022Legal notice