Dataset for CDS classical BH3-containing proteins of organism Monopterus albus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q3QZ16_BMF-01       -------------------------------atggac-------------
A0A3Q3QZ16_BMF-02       -------------------------------atggac-------------
A0A3Q3K6I5_BCL2L11      atgcacctatctagaccaccaaaccgctccgatggctcgaccgcagtaac
A0A3Q3R5S3_BAD-01       -------------------------------atggct-------------

A0A3Q3QZ16_BMF-01       --------------gatgaggaggatgatgtgtttgagcc---agacccc
A0A3Q3QZ16_BMF-02       --------------gatgaggaggatgatgtgtttgagcc---agacccc
A0A3Q3K6I5_BCL2L11      agcaacagaggagagcggagatccaccatctgtcggtgccgctggaacct
A0A3Q3R5S3_BAD-01       --------------------------------------------------

A0A3Q3QZ16_BMF-01       cactgctggcgtactgcattcagggagataaagtgtgaaga---------
A0A3Q3QZ16_BMF-02       cactgctggcgtactgcattcagggagataaagtgtgaaga---------
A0A3Q3K6I5_BCL2L11      cggcgcaaagctcccg--ttcgaacggcggcagcgagcggagctttggcc
A0A3Q3R5S3_BAD-01       ----gcaaacttcacgatttcagacagtg-----aatcagagtctt----
                            **     *   *  ***     *            **         

A0A3Q3QZ16_BMF-01       ---ccggggcacacag------------acagctggcc-ctaccctggca
A0A3Q3QZ16_BMF-02       ---ccggggcacacag------------acagctggcc-ctaccctggca
A0A3Q3K6I5_BCL2L11      accccggctcggccggaggagg------agagccggtc-tcgccttcccg
A0A3Q3R5S3_BAD-01       ----cggaggaggtagaggaaggaaaacacagccaatcatcaacttcgca
                            ***        *            * ***    *     * *  * 

A0A3Q3QZ16_BMF-01       ---ccgaacaacag--tatgctgccctgtggag------------ttgca
A0A3Q3QZ16_BMF-02       ---ccgaacaacag--tatgctgccctgtggag------------ttgca
A0A3Q3K6I5_BCL2L11      gtgcagaaccaaagccatcgctcctctcgacagcctaagcgtgtttcaca
A0A3Q3R5S3_BAD-01       ----agaacaacag--gttcctccatgccacagcct-----taccttacc
                             **** * **      ** *       **            *  * 

A0A3Q3QZ16_BMF-01       gaggatc--------------------------ccagaccactcttctat
A0A3Q3QZ16_BMF-02       gaggatc--------------------------ccagaccactcttctat
A0A3Q3K6I5_BCL2L11      caaggtctatattccacctccctcgccggtcctccagtggatatttctcc
A0A3Q3R5S3_BAD-01       tgagctcagaatggca-------------gcaaccagtcga---------
                           * **                          ****   *         

A0A3Q3QZ16_BMF-01       ggcaacgcaggttttcgattgcact----------tcccagcacactttg
A0A3Q3QZ16_BMF-02       ggcaacgcaggttttcgattgcact----------tcccagcacactttg
A0A3Q3K6I5_BCL2L11      aacgacagcgactctgtgccgagctccccgctctccccgaggccagtgac
A0A3Q3R5S3_BAD-01       ---aacag---------ggtgagct-----------cggagtccaat---
                            **              *  **           *  **  ** *   

A0A3Q3QZ16_BMF-01       agcttgt---------------tggggatcaggaagcgaggcgacaa---
A0A3Q3QZ16_BMF-02       agcttgt---------------tggggatcaggaagcgaggcgacaa---
A0A3Q3K6I5_BCL2L11      ggctgacaaagtcacgcagactccgagtcccagcagccaggtgatgaacc
A0A3Q3R5S3_BAD-01       -gcttccactgtc---------caggatgcca--agtcagatgagga---
                         ***                    *    *    **  **  **  *   

A0A3Q3QZ16_BMF-01       -----------------------------------gaggatcaaaac--g
A0A3Q3QZ16_BMF-02       -----------------------------------gaggatcaaaac--g
A0A3Q3K6I5_BCL2L11      acgccctgcagtgcatggctgaggcgc------acggcggtcga--ccgg
A0A3Q3R5S3_BAD-01       ----------------ggctggtacacccacagacggagctccattccgg
                                                           *  * ** *  *  *

A0A3Q3QZ16_BMF-01       ggatggagc-----------atctacccc----------------ggcag
A0A3Q3QZ16_BMF-02       ggatggagc-----------atctacccc----------------ggcag
A0A3Q3K6I5_BCL2L11      ggacgcaccggcaagatgcaagctcgcccagcccctctagcgcacggcag
A0A3Q3R5S3_BAD-01       ggacggtcc------aagtcagctccccctgctct----gtg---ggcag
                        *** *   *           * **  ***                *****

A0A3Q3QZ16_BMF-01       caacgtgtggcgcgcagtgtggaggcctgtat---tggccagaaactcca
A0A3Q3QZ16_BMF-02       caacgtgtggcgcgcagtgtggaggcctgtat---tggccagaaactcca
A0A3Q3K6I5_BCL2L11      cagaacgcaataagggacatgcaggcggaggcagttggacgagagctccg
A0A3Q3R5S3_BAD-01       caaa--gaaata-----------------------tggccggcagctccg
                        **    *                            *** *   * **** 

A0A3Q3QZ16_BMF-01       gctgataggagatcagtttcatcgagaacacctacagctgtatcatcgaa
A0A3Q3QZ16_BMF-02       gctgataggagatcagtttcatcgagaacacctacagctgtatcatcgaa
A0A3Q3K6I5_BCL2L11      acgcatcggagatgactataat---aaccaccttctg--gagttggcaga
A0A3Q3R5S3_BAD-01       aaggatgagcgatgagtttgac---a---gtctgctg--gacaaagggga
                            **  * *** * * * *          ** * *  *         *

A0A3Q3QZ16_BMF-01       accaaaggaaccaggggccgctgtggtggc--gcctgg---ccacaactc
A0A3Q3QZ16_BMF-02       accaaaggaaccaggggccgctgtggtggc--gcctgg---ccacaactc
A0A3Q3K6I5_BCL2L11      ca-gacgtagacgggttgtgccgcg--tatccaccaggaactcaccatcg
A0A3Q3R5S3_BAD-01       gatgaagagggtgaggagtgccggggcggccagccag--atgcacca---
                            * *       *    ** * *        ** *     *** *   

A0A3Q3QZ16_BMF-01       tgctcag----------------------ccttctgtttgataggggg--
A0A3Q3QZ16_BMF-02       tgctcag----------------------ccttctgtttgataggggg--
A0A3Q3K6I5_BCL2L11      tgctctgcgtgggcatcctggt-------ccttgtgattggtcagataat
A0A3Q3R5S3_BAD-01       --ctctaaaag------ctggtggagctacctctttagtcatcaggagac
                          ***                        ***  *   *  *  *     

A0A3Q3QZ16_BMF-01       ------------------------------ttcattgctggaggaggcgg
A0A3Q3QZ16_BMF-02       ------------------------------ttcattgctggaggaggcgg
A0A3Q3K6I5_BCL2L11      cttgcaaggcagtataaacagccaggacaactctcaggtttag-------
A0A3Q3R5S3_BAD-01       agagggagagaacacccaccatgaaaacgcggcgctggctcaggaggtag
                                                        *   *    **       

A0A3Q3QZ16_BMF-01       agcgggacggaggtga-
A0A3Q3QZ16_BMF-02       agcgggacggaggtga-
A0A3Q3K6I5_BCL2L11      -----------------
A0A3Q3R5S3_BAD-01       agcgggtcgtttcctaa

© 1998-2020Legal notice