Dataset for CDS classical BH3-containing proteins of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7CXT2_BCL2L11-02      --------------------------------------------------
F7CXT2_BCL2L11-01      --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
F7GL32_BBC3-02         --------------------------------------------------
F7GL32_BBC3-01         atgggtgtgcggccccgcggcgccccctggcgcccggagccggcgggggg
                                                                         

F7CXT2_BCL2L11-02      --------------------------------------------------
F7CXT2_BCL2L11-01      --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
F7GL32_BBC3-02         --------------------------------------------------
F7GL32_BBC3-01         cggcggggctgggggccgggcgaggggcacggccgggcgggcgcgtgcca
                                                                         

F7CXT2_BCL2L11-02      --------------------------------------------------
F7CXT2_BCL2L11-01      --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
F7GL32_BBC3-02         --------------------------------------------------
F7GL32_BBC3-01         ctgggcgtgttgttttccaggggctcggcgtgggcctccgcagtggtgag
                                                                         

F7CXT2_BCL2L11-02      --------------------------------------------------
F7CXT2_BCL2L11-01      --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
F7GL32_BBC3-02         --------------------------------------------------
F7GL32_BBC3-01         tgtgcgccgcggctgggggtgcgcgtgccgtgccgtgagcgggggccgct
                                                                         

F7CXT2_BCL2L11-02      --------------------------------------------------
F7CXT2_BCL2L11-01      --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
F7GL32_BBC3-02         --------------------------------------------------
F7GL32_BBC3-01         gtcaccgcgctgctgctgccgctgtgagtgcggggccggactggggaaac
                                                                         

F7CXT2_BCL2L11-02      --------------------------------------------------
F7CXT2_BCL2L11-01      --------------------------------------------------
F7G1G0_HRK-01          --------------------------------------------------
F7GL32_BBC3-02         --------------------------------------------------
F7GL32_BBC3-01         tgaggcggggccgggcccgaggggtggcaccgccgctcacctgctccgcc
                                                                         

F7CXT2_BCL2L11-02      ------------------------------------------atggcaaa
F7CXT2_BCL2L11-01      ------------------------------------------atggcaaa
F7G1G0_HRK-01          ------------------------------------------atg-----
F7GL32_BBC3-02         ------------------------------------------atggccag
F7GL32_BBC3-01         cacctgtctgtgtccctccgcaggctccctccccactggggcatggccag
                                                                 ***     

F7CXT2_BCL2L11-02      acaaccgtcagatctaaattctgagtgtgacagagaaggtggacaattgc
F7CXT2_BCL2L11-01      acaaccgtcagatctaaattctgagtgtgacagagaaggtggacaattgc
F7G1G0_HRK-01          --------------------------------------------------
F7GL32_BBC3-02         agcccagcaggatggcagctct-------ccggagccggtggaggg--gc
F7GL32_BBC3-01         agcccagcaggatggcagctct-------ccggagccggtggaggg--gc
                                                                         

F7CXT2_BCL2L11-02      agcctacagaaaggcctactcagcctcaacaactcagaccaggggcccct
F7CXT2_BCL2L11-01      agcctacagaaaggcctactcagcctcaacaactcagaccaggggcccct
F7G1G0_HRK-01          ------------------------------------tgcccgtgtcccct
F7GL32_BBC3-02         tgccccgggagagccccaggaccttccccctgggccggctcatgccctct
F7GL32_BBC3-01         tgccccgggagagccccaggaccttccccctgggccggctcatgccctct
                                                             *    * ** **

F7CXT2_BCL2L11-02      acctctatacaaacacagtatcaaggtaattcaggtgaaggggacagctg
F7CXT2_BCL2L11-01      acctctatacaaacacagtatca---------------------------
F7G1G0_HRK-01          gc----a-----ccgcggtcgcg-----------gt--------------
F7GL32_BBC3-02         gc----ggtctcctgcagcctct-----------gtgaggccggcttgaa
F7GL32_BBC3-01         gc----ggtctcctgcagcctct-----------gtgaggccggcttgaa
                        *             * *   *                            

F7CXT2_BCL2L11-02      ctcacccagcagtcctcagggaccgtttgcaccacccactagccctagtc
F7CXT2_BCL2L11-01      --------------------------------------------------
F7G1G0_HRK-01          --cccccggcgg---tgtgcgcctg-------------------------
F7GL32_BBC3-02         cccctctggcgactccatgtgcccagc---------------cccggggc
F7GL32_BBC3-01         cccctctggcgactccatgtgcccagc---------------cccggggc
                                                                         

F7CXT2_BCL2L11-02      catttgctaccagatccccacttttcatctttttaagaagatctccactg
F7CXT2_BCL2L11-01      --------------------------------------------------
F7G1G0_HRK-01          cagctcggac---------------------cgcctggaacagcgcgcgg
F7GL32_BBC3-02         cagcgctggcaccctcttccctcctgcccctcgcttacttctgcacgcga
F7GL32_BBC3-01         cagcgctggcaccctcttccctcctgcccctcgcttacttctgcacgcga
                                                                         

F7CXT2_BCL2L11-02      ctgcctcgatcttccagtgggtatttctcttttgacacagacaggagtcc
F7CXT2_BCL2L11-01      --------------------------------------agacaggagtcc
F7G1G0_HRK-01          c----------------------------------ggcggc----agcac
F7GL32_BBC3-02         cagccccgtgcctatgggggcccccgctgggcacgggcggccaggagccc
F7GL32_BBC3-01         cagccccgtgcctatgggggcccccgctgggcacgggcggccaggagccc
                                                              *     **  *

F7CXT2_BCL2L11-02      agcgcctatgagttgtgataaatctacacaaactccaagccctccttgtc
F7CXT2_BCL2L11-01      agcgcctatgagttgtgataaatctacacaaactccaagccctccttgtc
F7G1G0_HRK-01          agctcacggccgc---------------ccgcctcaaggcgctt------
F7GL32_BBC3-02         ggcggccggcaac---------------cagggccaaagcggttccctgc
F7GL32_BBC3-01         ggcggccggcaac---------------cagggccaaagcggttccctgc
                        **                         *     * * **  *       

F7CXT2_BCL2L11-02      aagccttcaatca-----ttatctaagtgcaatgggtaagcaagatcatg
F7CXT2_BCL2L11-01      aagccttcaatca-----ttatctaagtgcaatg---------------g
F7G1G0_HRK-01          ---------------------------------ggggac--------gag
F7GL32_BBC3-02         cctccctgggccccaggtctgcccaggaggaggggggacaggagggagag
F7GL32_BBC3-01         cctccctgggccccaggtctgcccaggaggaggggggacaggagggagag
                                                        *               *

F7CXT2_BCL2L11-02      cttccatgaggcagtctcaatca----------atacctgcagatatgcg
F7CXT2_BCL2L11-01      cttccatgaggcagtctcaatca----------atacctgcagatatgcg
F7G1G0_HRK-01          ctgc----aggaacgg---accatgt-------------ggaggcgccgg
F7GL32_BBC3-02         cccc----agggagcgtcccccatgtctggcggccccccgggggtgttag
F7GL32_BBC3-01         cccc----agggagcgtcccccatgtctggcggccccccgggggtgttag
                       *  *    *** *        **                *  *      *

F7CXT2_BCL2L11-02      gccagaaatttgga----------------------------ttgcacaa
F7CXT2_BCL2L11-01      gccagaaatttgga----------------------------ttgcacaa
F7G1G0_HRK-01          gcgcggag----------------------------------tcggcggg
F7GL32_BBC3-02         gcccggagcacggggaccaaggcgagcagcaggaccgggagatcggcgcc
F7GL32_BBC3-01         gcccggagcacggggaccaaggcgagcagcaggaccgggagatcggcgcc
                       **  * *                                   * *     

F7CXT2_BCL2L11-02      gaattgcgccgtattggagatgaatttaatgcttcctattatccaagaag
F7CXT2_BCL2L11-01      gaattgcgccgtattggagatgaatttaatgcttcctattatccaagaag
F7G1G0_HRK-01          ccgcagcggagg-cggccg----------------------gcagcggcg
F7GL32_BBC3-02         cagctgcgcaggatggccgatgacctcaacgccctgtacgagcagcggag
F7GL32_BBC3-01         cagctgcgcaggatggccgatgacctcaacgccctgtacgagcagcggag
                            ***  *    *  *                       *   *  *

F7CXT2_BCL2L11-02      ggggtttttggataataactatcaaggagcaggtgaccatcac------c
F7CXT2_BCL2L11-01      g---------------------------gcag------------------
F7G1G0_HRK-01          gcg-------------------------gcgggctccccgccta-----c
F7GL32_BBC3-02         acgggaggagga----------------gcagaggcgccacctgtcgccc
F7GL32_BBC3-01         acgggaggagga----------------gcagaggcgccacctgtcgccc
                                                   ** *                  

F7CXT2_BCL2L11-02      aaatggttattttacg--------cctgttacgttaca------tcatcc
F7CXT2_BCL2L11-01      --------------------------tgtggcattgtt------tcaaga
F7G1G0_HRK-01          tgggcttggctgtgcgcggccgctcatgtggcggcgctggcggcctggct
F7GL32_BBC3-02         tggaggctgctgtaca----atctcatct--cggggct-----cctggcc
F7GL32_BBC3-01         tggaggctgctgtaca----atctcatct--cggggct-----cctggcc
                                                 * *  *                  

F7CXT2_BCL2L11-02      gcctt---------gtttggagaatgcagtga-----------
F7CXT2_BCL2L11-01      gctttgggattggagttggaagtcagctttga-----------
F7G1G0_HRK-01          gctccggaggagaaacttg---------------------tag
F7GL32_BBC3-02         -ccccagcgaaggaaccggatgccggacgtggagcccaactag
F7GL32_BBC3-01         -ccccagcgaaggaaccggatgccggacgtggagcccaactag
                        *                *                        

© 1998-2020Legal notice