Dataset for CDS classical BH3-containing proteins of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8GKJ8_BMF-01       --------------------------------------------------
A0A5F8GA49_BAD-01       --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
F7GL32_BBC3-01          atgggtgtgcggccccgcggcgccccctggcgcccggagccggcgggggg
F7GL32_BBC3-02          --------------------------------------------------
                                                                          

A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8GKJ8_BMF-01       --------------------------------------------------
A0A5F8GA49_BAD-01       --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
F7GL32_BBC3-01          cggcggggctgggggccgggcgaggggcacggccgggcgggcgcgtgcca
F7GL32_BBC3-02          --------------------------------------------------
                                                                          

A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8GKJ8_BMF-01       --------------------------------------------------
A0A5F8GA49_BAD-01       --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
F7GL32_BBC3-01          ctgggcgtgttgttttccaggggctcggcgtgggcctccgcagtggtgag
F7GL32_BBC3-02          --------------------------------------------------
                                                                          

A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8GKJ8_BMF-01       --------------------------------------------------
A0A5F8GA49_BAD-01       --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
F7GL32_BBC3-01          tgtgcgccgcggctgggggtgcgcgtgccgtgccgtgagcgggggccgct
F7GL32_BBC3-02          --------------------------------------------------
                                                                          

A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8GKJ8_BMF-01       --------------------------------------------------
A0A5F8GA49_BAD-01       --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
F7GL32_BBC3-01          gtcaccgcgctgctgctgccgctgtgagtgcggggccggactggggaaac
F7GL32_BBC3-02          --------------------------------------------------
                                                                          

A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8GKJ8_BMF-01       --------------------------------------------------
A0A5F8GA49_BAD-01       --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
F7GL32_BBC3-01          tgaggcggggccgggcccgaggggtggcaccgccgctcacctgctccgcc
F7GL32_BBC3-02          --------------------------------------------------
                                                                          

A0A5F8H037_BCL2L11      ------------------------------------------atg-----
A0A5F8H037_BCL2L11      ------------------------------------------atg-----
A0A5F8GKJ8_BMF-01       ------------------------------------------atg-----
A0A5F8GA49_BAD-01       ------------------------------------------atgacagt
F7G1G0_HRK-01           ------------------------------------------atg-----
F7GL32_BBC3-01          cacctgtctgtgtccctccgcaggctccctccccactggggcatg-----
F7GL32_BBC3-02          ------------------------------------------atg-----
                                                                  ***     

A0A5F8H037_BCL2L11      -------gcaaaacaaccgtcagatctaaattct---gagtgtgacagag
A0A5F8H037_BCL2L11      -------gcaaaacaaccgtcagatctaaattct---gagtgtgacagag
A0A5F8GKJ8_BMF-01       ----------------------------gagcctcctcactatgtg----
A0A5F8GA49_BAD-01       ttctctcacccaggcaacgggggctgggctcccaccgaaacaggagagag
F7G1G0_HRK-01           --------------------------------------------------
F7GL32_BBC3-01          -------gccagagcccagcaggatggcagctctccggagccggtg---g
F7GL32_BBC3-02          -------gccagagcccagcaggatggcagctctccggagccggtg---g
                                                                          

A0A5F8H037_BCL2L11      aaggtggacaattgcagcctacagaaa---------------ggcctact
A0A5F8H037_BCL2L11      aaggtggacaattgcagcctacagaaa---------------ggcctact
A0A5F8GKJ8_BMF-01       -------------gaagagctagaggac--------------gatgtgtt
A0A5F8GA49_BAD-01       gaggagggggaggagagagcccgggagccgagcacagggacctggctgct
F7G1G0_HRK-01           ------------------------------------------tgcccgtg
F7GL32_BBC3-01          aggggctgccccgggagagccccaggaccttccccctgggccggctcatg
F7GL32_BBC3-02          aggggctgccccgggagagccccaggaccttccccctgggccggctcatg
                                                                          

A0A5F8H037_BCL2L11      cagcctcaacaactcagaccaggggcccctacctctatacaaacacagta
A0A5F8H037_BCL2L11      cagcctcaacaactcagaccaggggcccctacctctatacaaacacagta
A0A5F8GKJ8_BMF-01       ccacccggaggactcaga-----------gcctggtgctcagccaggggg
A0A5F8GA49_BAD-01       gcccct-cgggagtcgga-----------gacccc---------------
F7G1G0_HRK-01           tcccctgca-----ccgc-----------ggtcgcggt------------
F7GL32_BBC3-01          ccctctgcggtctcctgc-----------agcctctgtgaggccggcttg
F7GL32_BBC3-02          ccctctgcggtctcctgc-----------agcctctgtgaggccggcttg
                            *         * *                                 

A0A5F8H037_BCL2L11      tca-----------------------------------------------
A0A5F8H037_BCL2L11      tcaaggtaattcaggtgaaggggacagctgctcacccagcagtcctcagg
A0A5F8GKJ8_BMF-01       cct--------------------------------------gacctcagc
A0A5F8GA49_BAD-01       ------------------------------------------ctcctggc
F7G1G0_HRK-01           ------------------------------------------cccccggc
F7GL32_BBC3-01          aac--------------------------------------ccctctggc
F7GL32_BBC3-02          aac--------------------------------------ccctctggc
                                                                          

A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      gaccgtttgcaccacccactagccctagtccatttgctaccagatcccca
A0A5F8GKJ8_BMF-01       tgctctgtttgcccagagccagcctgactatatgctggatgggctgcagc
A0A5F8GA49_BAD-01       cggacgatgcctcccgccccgtg---------------------------
F7G1G0_HRK-01           gg---tgtgcgcctg----------ca----gctcggac-----------
F7GL32_BBC3-01          gactccatgtgcccagccccggggcca----gcgctggcaccctcttccc
F7GL32_BBC3-02          gactccatgtgcccagccccggggcca----gcgctggcaccctcttccc
                                                                          

A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      cttttcatctttttaagaagatctccactgctgcctcgatcttccagtgg
A0A5F8GKJ8_BMF-01       ttttccctcttactcactgctgtggcccagg-------------------
A0A5F8GA49_BAD-01       ----------agcatgtttcaga-tcccaga-------------------
F7G1G0_HRK-01           ----------cgcctggaacagc-gcgcggc-------------------
F7GL32_BBC3-01          tcctgcccctcgcttacttctgc-acgcgacagccccgtgcctatggggg
F7GL32_BBC3-02          tcctgcccctcgcttacttctgc-acgcgacagccccgtgcctatggggg
                                                                          

A0A5F8H037_BCL2L11      ------------------agacaggagtccagcgcctatgagttgtgata
A0A5F8H037_BCL2L11      gtatttctcttttgacacagacaggagtccagcgcctatgagttgtgata
A0A5F8GKJ8_BMF-01       -----gcttcggtcagttggccaggaagata-----------------ag
A0A5F8GA49_BAD-01       -----gtttgagccgggcgagcaggaagacggctctgagcgggcgccggg
F7G1G0_HRK-01           ---------------ggcggc----agcacagctca------------cg
F7GL32_BBC3-01          cccccgctgggcacgggcggccaggagcccggcggc------------cg
F7GL32_BBC3-02          cccccgctgggcacgggcggccaggagcccggcggc------------cg
                                                 *                        

A0A5F8H037_BCL2L11      aatctacacaaactcc---aagccctccttgtcaagccttcaatca----
A0A5F8H037_BCL2L11      aatctacacaaactcc---aagccctccttgtcaagccttcaatca----
A0A5F8GKJ8_BMF-01       gccactcagactctcagtccagcatcccccag-----ccaaggtgtcatg
A0A5F8GA49_BAD-01       gcagcccggggggccaggcagacgcagctccgcagcccctggagcccag-
F7G1G0_HRK-01           gccgccc---gcctca---aggcgctt-----------------------
F7GL32_BBC3-01          gcaacca---gggcca---aagcggttccctgccctccctgggccccagg
F7GL32_BBC3-02          gcaacca---gggcca---aagcggttccctgccctccctgggccccagg
                                      *       *                           

A0A5F8H037_BCL2L11      -ttatctaagtgcaatg---------------gcttccatgagg------
A0A5F8H037_BCL2L11      -ttatctaagtgcaatgggtaagcaagatcatgcttccatgagg------
A0A5F8GKJ8_BMF-01       ctgcctt---------gtggagtgactgaagagccccaccgactctttta
A0A5F8GA49_BAD-01       -cgccacgagggcgcgggggacaggcggccccgcctgatctcct------
F7G1G0_HRK-01           ----------------ggggac--------gagctgcaggaacg------
F7GL32_BBC3-01          tctgcccaggaggaggggggacaggagggagagccccagggagc------
F7GL32_BBC3-02          tctgcccaggaggaggggggacaggagggagagccccagggagc------
                                        *               **                

A0A5F8H037_BCL2L11      -----------------------cagtctcaatcaatacc--tgcagata
A0A5F8H037_BCL2L11      -----------------------cagtctcaatcaatacc--tgcagata
A0A5F8GKJ8_BMF-01       tggcaatgctggatatcgacttcccctcccagccagttttcctgctagcc
A0A5F8GA49_BAD-01       ------------------accccccactccgggaggggccggcggtggag
F7G1G0_HRK-01           ------------------g---accatgt--------------ggaggcg
F7GL32_BBC3-01          ------------------gtcccccatgtctggc-ggccccccgggggtg
F7GL32_BBC3-02          ------------------gtcccccatgtctggc-ggccccccgggggtg
                                               *                   *      

A0A5F8H037_BCL2L11      tgcggccagaaatttggattgcacaagaa--------------------t
A0A5F8H037_BCL2L11      tgcggccagaaatttggattgcacaagaa--------------------t
A0A5F8GKJ8_BMF-01       tgcggcttggag-aggagccccctgaagagcagtggga--------gcat
A0A5F8GA49_BAD-01       gtgggtcccgaggccggagcccaggcaga--------------------g
F7G1G0_HRK-01           ccgggcgcggag----------------------------------tcgg
F7GL32_BBC3-01          ttaggcccggagcacggggaccaaggcgagcagcaggaccgggagatcgg
F7GL32_BBC3-02          ttaggcccggagcacggggaccaaggcgagcagcaggaccgggagatcgg
                           **     *                                       

A0A5F8H037_BCL2L11      tgcgccgtattggagatgaa---------------------------ttt
A0A5F8H037_BCL2L11      tgcgccgtattggagatgaa---------------------------ttt
A0A5F8GKJ8_BMF-01       cgagccgaggtgcagattgcccaaaagc-------------------ttc
A0A5F8GA49_BAD-01       cgggccgaggcggaggaggaccggggcctgttccggagccgctccagctc
F7G1G0_HRK-01           cgggccgcagcggagg-cggccg---------------------------
F7GL32_BBC3-01          cgcccagctgcgcaggatggccgatgac-------------------ctc
F7GL32_BBC3-02          cgcccagctgcgcaggatggccgatgac-------------------ctc
                         *  * *    * **                                   

A0A5F8H037_BCL2L11      aatgcttcctattatccaagaagg--------------------------
A0A5F8H037_BCL2L11      aatgcttcctattatccaagaagggggtttttggataataactatcaagg
A0A5F8GKJ8_BMF-01       aatgc-------------------------------------------at
A0A5F8GA49_BAD-01       tgcaccccctatcctctgggccgc-------------gcggcgatatggc
F7G1G0_HRK-01           ------------------------------------------------gc
F7GL32_BBC3-01          aacgccctgtac----------------------------------gagc
F7GL32_BBC3-02          aacgccctgtac----------------------------------gagc
                                                                          

A0A5F8H037_BCL2L11      -gcag------------------------------tgt------------
A0A5F8H037_BCL2L11      agcaggtgaccatcaccaaatggttattttacgcctgt------------
A0A5F8GKJ8_BMF-01       agcgg--acc-------agttccatagactccacatgc------------
A0A5F8GA49_BAD-01       agcga--gctccgcagaatgagcgacgagttcgattgcagcttcaaggga
F7G1G0_HRK-01           agcgg--cggcg---------gcgggctccccgccta-------------
F7GL32_BBC3-01          agcgg--agacgggaggaggagcagaggcgccacctgt------------
F7GL32_BBC3-02          agcgg--agacgggaggaggagcagaggcgccacctgt------------
                         **                                *              

A0A5F8H037_BCL2L11      -----------------------ggcattgtttcaagagctttgggattg
A0A5F8H037_BCL2L11      -----------------------tacgttacatcatccgcctt-------
A0A5F8GKJ8_BMF-01       ------------agcggcaccagcagaaccgaaaccatgtgtggtggcaa
A0A5F8GA49_BAD-01       cttccgcgcccgaagagcgccggcactgcgagccagatgcgtcggagcca
F7G1G0_HRK-01           ----------ctgggcttggctgtgcgcggccgctcatgtggcggcgctg
F7GL32_BBC3-01          ------cgccctggaggctgctgtaca----atctcatct--cggggct-
F7GL32_BBC3-02          ------cgccctggaggctgctgtaca----atctcatct--cggggct-
                                                                          

A0A5F8H037_BCL2L11      gagttg------------------------------------gaagtcag
A0A5F8H037_BCL2L11      --gttt------------------------------------ggagaatg
A0A5F8GKJ8_BMF-01       a---tcctcctcttccttcacaacttggccttgaacaga---gaggagaa
A0A5F8GA49_BAD-01       cggttggacccgcaccgtccagtcttggttcgggcggaatttggggaaag
F7G1G0_HRK-01           gcggcctggctgctccgga-----------------------ggagaaac
F7GL32_BBC3-01          ----cctggcc-ccccagc-----------------------gaaggaac
F7GL32_BBC3-02          ----cctggcc-ccccagc-----------------------gaaggaac
                                                                  *  *    

A0A5F8H037_BCL2L11      ctt---------------------tga
A0A5F8H037_BCL2L11      cag---------------------tga
A0A5F8GKJ8_BMF-01       caggaatggggcaggc--cctaggtga
A0A5F8GA49_BAD-01       ggggcgccggtcct----tcccactaa
F7G1G0_HRK-01           ttg---------------------tag
F7GL32_BBC3-01          cggatgccggacgtggagcccaactag
F7GL32_BBC3-02          cggatgccggacgtggagcccaactag
                                                *  

© 1998-2022Legal notice