Dataset for CDS BBC3 of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F7GL32_BBC3-01      atgggtgtgcggccccgcggcgccccctggcgcccggagccggcggggggcggcggggct
F7GL32_BBC3-02      ------------------------------------------------------------

F7GL32_BBC3-01      gggggccgggcgaggggcacggccgggcgggcgcgtgccactgggcgtgttgttttccag
F7GL32_BBC3-02      ------------------------------------------------------------

F7GL32_BBC3-01      gggctcggcgtgggcctccgcagtggtgagtgtgcgccgcggctgggggtgcgcgtgccg
F7GL32_BBC3-02      ------------------------------------------------------------

F7GL32_BBC3-01      tgccgtgagcgggggccgctgtcaccgcgctgctgctgccgctgtgagtgcggggccgga
F7GL32_BBC3-02      ------------------------------------------------------------

F7GL32_BBC3-01      ctggggaaactgaggcggggccgggcccgaggggtggcaccgccgctcacctgctccgcc
F7GL32_BBC3-02      ------------------------------------------------------------

F7GL32_BBC3-01      cacctgtctgtgtccctccgcaggctccctccccactggggcatggccagagcccagcag
F7GL32_BBC3-02      ------------------------------------------atggccagagcccagcag

F7GL32_BBC3-01      gatggcagctctccggagccggtggaggggctgccccgggagagccccaggaccttcccc
F7GL32_BBC3-02      gatggcagctctccggagccggtggaggggctgccccgggagagccccaggaccttcccc

F7GL32_BBC3-01      ctgggccggctcatgccctctgcggtctcctgcagcctctgtgaggccggcttgaacccc
F7GL32_BBC3-02      ctgggccggctcatgccctctgcggtctcctgcagcctctgtgaggccggcttgaacccc

F7GL32_BBC3-01      tctggcgactccatgtgcccagccccggggccagcgctggcaccctcttccctcctgccc
F7GL32_BBC3-02      tctggcgactccatgtgcccagccccggggccagcgctggcaccctcttccctcctgccc

F7GL32_BBC3-01      ctcgcttacttctgcacgcgacagccccgtgcctatgggggcccccgctgggcacgggcg
F7GL32_BBC3-02      ctcgcttacttctgcacgcgacagccccgtgcctatgggggcccccgctgggcacgggcg

F7GL32_BBC3-01      gccaggagcccggcggccggcaaccagggccaaagcggttccctgccctccctgggcccc
F7GL32_BBC3-02      gccaggagcccggcggccggcaaccagggccaaagcggttccctgccctccctgggcccc

F7GL32_BBC3-01      aggtctgcccaggaggaggggggacaggagggagagccccagggagcgtcccccatgtct
F7GL32_BBC3-02      aggtctgcccaggaggaggggggacaggagggagagccccagggagcgtcccccatgtct

F7GL32_BBC3-01      ggcggccccccgggggtgttaggcccggagcacggggaccaaggcgagcagcaggaccgg
F7GL32_BBC3-02      ggcggccccccgggggtgttaggcccggagcacggggaccaaggcgagcagcaggaccgg

F7GL32_BBC3-01      gagatcggcgcccagctgcgcaggatggccgatgacctcaacgccctgtacgagcagcgg
F7GL32_BBC3-02      gagatcggcgcccagctgcgcaggatggccgatgacctcaacgccctgtacgagcagcgg

F7GL32_BBC3-01      agacgggaggaggagcagaggcgccacctgtcgccctggaggctgctgtacaatctcatc
F7GL32_BBC3-02      agacgggaggaggagcagaggcgccacctgtcgccctggaggctgctgtacaatctcatc

F7GL32_BBC3-01      tcggggctcctggccccccagcgaaggaaccggatgccggacgtggagcccaactag
F7GL32_BBC3-02      tcggggctcctggccccccagcgaaggaaccggatgccggacgtggagcccaactag

© 1998-2021Legal notice