Dataset for CDS PMAIP1 of organism Microcebus murinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B7HMR3_PMAIP1-      atgcccgtgaagaaggcgcgcaagaacgcgcagccgagcccgacgcggac
A0A8B7HMR3_PMAIP1-      atgcccgtgaagaaggcgcgcaagaacgcgcagccgagcccgacgcggac
                        **************************************************

A0A8B7HMR3_PMAIP1-      tcgggcaggtactggccggaccgcggagacggcgagggagggagcccggt
A0A8B7HMR3_PMAIP1-      tcgggcagagatcga-----------------------------------
                        ********  *  *                                    

A0A8B7HMR3_PMAIP1-      gtggcgttgggatgcaactacaatttttagctccttctctgctcttccct
A0A8B7HMR3_PMAIP1-      --------------------------------------------------
                                                                          

A0A8B7HMR3_PMAIP1-      cctccttgcttacccttccccggggatgacatcacctcaggcagaagaat
A0A8B7HMR3_PMAIP1-      ------------------------------------------agaagaat
                                                                  ********

A0A8B7HMR3_PMAIP1-      gtgttcttcaactcaggagaatcggagacaaactgcatttccagcagaaa
A0A8B7HMR3_PMAIP1-      gtgttcttcaactcaggagaatcggagacaaactgcatttccagcagaaa
                        **************************************************

A0A8B7HMR3_PMAIP1-      ctactgaatttgatagtcaaacttttccgctcaggaacctgactgacttt
A0A8B7HMR3_PMAIP1-      ctactgaatttgatagtcaaacttttccgctcaggaacctga--------
                        ******************************************        

A0A8B7HMR3_PMAIP1-      tcccaaagtaggtacaaatttcatcaattagaagacagatctcactgtaa
A0A8B7HMR3_PMAIP1-      --------------------------------------------------
                                                                          

A0A8B7HMR3_PMAIP1-      ttga
A0A8B7HMR3_PMAIP1-      ----
                            

© 1998-2022Legal notice