Dataset for CDS classical BH3-containing proteins of organism Microcebus murinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

18 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B7HMR3_PMAIP1-      atg-----------------------------------------------
A0A8B7HMR3_PMAIP1-      atg-----------------------------------------------
A0A8B7EUP7_BCL2L11      atggca--------------------------------------------
A0A8B7EUP7_BCL2L11      atggca--------------------------------------------
A0A8B7EUP7_BCL2L11      atggca--------------------------------------------
A0A8B7EUP7_BCL2L11      atggca--------------------------------------------
A0A8B7EUP7_BCL2L11      atggca--------------------------------------------
A0A8B7EUP7_BCL2L11      atggca--------------------------------------------
A0A8B7EUP7_BCL2L11      atggca--------------------------------------------
A0A8C5UXV9_BMF-01       atg-----------------------------------------------
A0A8C5UXV9_BMF-02       atg-----------------------------------------------
A0A8C5UXV9_BMF-03       atg-----------------------------------------------
A0A8C5VCL0_BAD-01       atgt----------------------------------------------
A0A8C5YCP8_BIK-01       atgt---ctgaggtga----------------------------------
A0A8B7FTF7_HRK-01       atgt----------------------------------------------
A0A8B7G497_BBC3-02      atgaaatttggtgtggggtct-----------------------------
A0A8B7G497_BBC3-01      --------------------------------------------------
A0A8B7G497_BBC3-03      atgaaatttggtgtggggtctgcccgggcatgtccgtgccaggcgcccag
                                                                          

A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8C5UXV9_BMF-01       --------------------------------------------------
A0A8C5UXV9_BMF-02       --------------------------------------------------
A0A8C5UXV9_BMF-03       --------------------------------------------------
A0A8C5VCL0_BAD-01       --------------------------------------------------
A0A8C5YCP8_BIK-01       --------------------------------------------------
A0A8B7FTF7_HRK-01       --------------------------------------------------
A0A8B7G497_BBC3-02      --------------------------------------------------
A0A8B7G497_BBC3-01      --------------------------------------------------
A0A8B7G497_BBC3-03      ggcttccttctcgcggtgtgtcccgggccatattcgcggccccagggagc
                                                                          

A0A8B7HMR3_PMAIP1-      -------------ccc----------------------------------
A0A8B7HMR3_PMAIP1-      -------------ccc----------------------------------
A0A8B7EUP7_BCL2L11      ------aagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
A0A8B7EUP7_BCL2L11      ------aagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
A0A8B7EUP7_BCL2L11      ------aagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
A0A8B7EUP7_BCL2L11      ------aagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
A0A8B7EUP7_BCL2L11      ------aagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
A0A8B7EUP7_BCL2L11      ------aagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
A0A8B7EUP7_BCL2L11      ------aagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
A0A8C5UXV9_BMF-01       ------gaaccatccc------------------------------agtg
A0A8C5UXV9_BMF-02       ------gaaccatccc------------------------------agtg
A0A8C5UXV9_BMF-03       ------gaaccatccc------------------------------agtg
A0A8C5VCL0_BAD-01       ------tccagatccc------------------------------agag
A0A8C5YCP8_BIK-01       ------gacccagccc----------------cacggacctcttcatgga
A0A8B7FTF7_HRK-01       ------gcccgtgccc----------------------------------
A0A8B7G497_BBC3-02      ------gcccgggcatgtccg---------tgccaggcgccc----aggg
A0A8B7G497_BBC3-01      ---atggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
A0A8B7G497_BBC3-03      gccatggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
                                     *                                    

A0A8B7HMR3_PMAIP1-      -------------gtgaagaaggcgcgcaagaacgcgcag----------
A0A8B7HMR3_PMAIP1-      -------------gtgaagaaggcgcgcaagaacgcgcag----------
A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggc--------ctgg
A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggc--------ctgg
A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggc--------ctgg
A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggc--------ctgg
A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggc--------ctgg
A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggc--------ctgg
A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggc--------ctgg
A0A8C5UXV9_BMF-01       tgtggaggagctggaggatgacgtgttccaaccagaggatggggagtcgg
A0A8C5UXV9_BMF-02       tgtggaggagctggaggatgacgtgttccaaccagaggatggggagtcgg
A0A8C5UXV9_BMF-03       tgtggaggagctggaggatgacgtgttccaaccagaggatggggagtcgg
A0A8C5VCL0_BAD-01       tttgagccaagtgagcaggaagac--tccagctctgcagataggggcctg
A0A8C5YCP8_BIK-01       cg---------------------ccttcccgttcgagcatc---tgctgg
A0A8B7FTF7_HRK-01       ---------------------------cctgcaccgcggc------cgcg
A0A8B7G497_BBC3-02      ctt--------------------ccttctcgc------------------
A0A8B7G497_BBC3-01      cctggcccgcgacggcccgcgccccttcccgctcggccgc------ctgg
A0A8B7G497_BBC3-03      cctggcccgcgacggcccgcgccccttcccgctcggccgc------ctgg
                                                   *                      

A0A8B7HMR3_PMAIP1-      ----ccgagcccgacgcggactcg------ggc-----------------
A0A8B7HMR3_PMAIP1-      ----ccgagcccgacgcggactcg------ggc-----------------
A0A8B7EUP7_BCL2L11      ggcccctacctccctacagacag-------agccccaag-----------
A0A8B7EUP7_BCL2L11      ggcccctacctccctacagacag-------agccccaaggtaat------
A0A8B7EUP7_BCL2L11      ggcccctacctccctacagacag-------agccccaaggtaat------
A0A8B7EUP7_BCL2L11      ggcccctacctccctacagacag-------agccccaaggtaat------
A0A8B7EUP7_BCL2L11      ggcccctacctccctacagacag-------agccccaaggtaat------
A0A8B7EUP7_BCL2L11      ggcccctacctccctacagacag-------agccccaaggtaat------
A0A8B7EUP7_BCL2L11      ggcccctacctccctacagacag-------agcccca-------------
A0A8C5UXV9_BMF-01       ggacccagcccggaagcgtgctctc-----tgc-----------------
A0A8C5UXV9_BMF-02       ggacccagcccggaagcgtgctctc-----tgc-----------------
A0A8C5UXV9_BMF-03       ggacccagcccggaagcgtgctctc-----tgc-----------------
A0A8C5VCL0_BAD-01       ggccccagcccctcaggggacctgcccccaggccccagcaagca------
A0A8C5YCP8_BIK-01       accctctgatcct--ggaggttctc-----agcatcatggagga------
A0A8B7FTF7_HRK-01       gccccccggccgt--gtgcgcctgc-----agc----gcggggc------
A0A8B7G497_BBC3-02      --------ggtgt--gt---cccgg-----gccatattcg----------
A0A8B7G497_BBC3-01      tgccctcggctgt--gt---cctgc-----ggcctctgcgagcccggcct
A0A8B7G497_BBC3-03      tgccctcggctgt--gt---cctgc-----ggcctctgcgagcccggcct
                                                        *                 

A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8C5UXV9_BMF-01       --------------------------------------------------
A0A8C5UXV9_BMF-02       --------------------------------------------------
A0A8C5UXV9_BMF-03       --------------------------------------------------
A0A8C5VCL0_BAD-01       --------------------------------------------------
A0A8C5YCP8_BIK-01       --------------------------------------------------
A0A8B7FTF7_HRK-01       --------------------------------------------------
A0A8B7G497_BBC3-02      --------------------------------------------------
A0A8B7G497_BBC3-01      gcccgctgcccccgccgcccccgccctgctccccgccgcctacctctgcg
A0A8B7G497_BBC3-03      gcccgctgcccccgccgcccccgccctgctccccgccgcctacctctgcg
                                                                          

A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      ------------cccgaaggcagtcgggaaggcgaaggggaccgctgccc
A0A8B7EUP7_BCL2L11      ------------cccgaaggcagtcgggaaggcgaaggggaccgctgccc
A0A8B7EUP7_BCL2L11      ------------cccgaaggcagtcgggaaggcgaaggggaccgctgccc
A0A8B7EUP7_BCL2L11      ------------cccgaaggcagtcgggaaggcgaaggggaccgctgccc
A0A8B7EUP7_BCL2L11      ------------cccgaaggcagtcgggaaggcgaaggggaccgctgccc
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8C5UXV9_BMF-01       -----------------------------tgacctgtttgcccagagcca
A0A8C5UXV9_BMF-02       -----------------------------tgacctgtttgcccagagcca
A0A8C5UXV9_BMF-03       -----------------------------tgacctgtttgcccagagcca
A0A8C5VCL0_BAD-01       -----------------------------tccctgcacagctccaagctt
A0A8C5YCP8_BIK-01       --------------------------------cgagcaggaccccagccc
A0A8B7FTF7_HRK-01       -------------------------------------------------g
A0A8B7G497_BBC3-02      --------------------------------------------------
A0A8B7G497_BBC3-01      cccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctgg
A0A8B7G497_BBC3-03      cccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctgg
                                                                          

A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      ccacggcagccctcagggcccgctggccccaccggccagccctggccctt
A0A8B7EUP7_BCL2L11      ccacggcagccctcagggcccgctggccccaccggccagccctggccctt
A0A8B7EUP7_BCL2L11      ccacggcagccctcagggcccgctggccccaccggccagccctggccctt
A0A8B7EUP7_BCL2L11      ccacggcagccctcagggcccgctggccccaccggccagccctggccctt
A0A8B7EUP7_BCL2L11      ccacggcagccctcagggcccgctggccccaccggccagccctggccctt
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8C5UXV9_BMF-01       gctggactgccccctcagccggcttcagctcttccctctcacccactgct
A0A8C5UXV9_BMF-02       gctggactgccccctcagccggcttcagctcttccctctcacccactgct
A0A8C5UXV9_BMF-03       gctggactgccccctcagccggcttcagctcttccctctcacccactgct
A0A8C5VCL0_BAD-01       cctgggg-------------gacgccag----------tcaccagcaggg
A0A8C5YCP8_BIK-01       ctcgggg------------tgcctcgaa----------gacagtgagcag
A0A8B7FTF7_HRK-01       cctgggg-------------------------------------------
A0A8B7G497_BBC3-02      --------------------------------------------------
A0A8B7G497_BBC3-01      cctgggggtccccgcagccggccccgag----------gcccgcgcccgg
A0A8B7G497_BBC3-03      cctgggggtccccgcagccggccccgag----------gcccgcgcccgg
                                                                          

A0A8B7HMR3_PMAIP1-      --------aggtactggccggaccgcggagacggcgagggagggagcccg
A0A8B7HMR3_PMAIP1-      --------agagatcga---------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      ttgctaccagatccccgcttttcatctttgtgagaagatcctccctgctg
A0A8B7EUP7_BCL2L11      ttgctaccagatccccgcttttcatctttgtgagaagatcctccctgctg
A0A8B7EUP7_BCL2L11      ttgctaccagatccccgcttttcatctttgtgagaagatcctccctgctg
A0A8B7EUP7_BCL2L11      ttgctaccagatccccgcttttcatctttgtgagaagatcctccctgctg
A0A8B7EUP7_BCL2L11      ttgctaccagatccccgcttttcatctttgtgagaagatcctccctgctg
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8C5UXV9_BMF-01       gtggccctgggcttcgacccaccagccaggaagacaaggccacccagacc
A0A8C5UXV9_BMF-02       gtggccctgggcttcgacccaccagccaggaagacaaggccacccagacc
A0A8C5UXV9_BMF-03       gtggccctgggcttcgacccaccagccaggaagacaaggccacccagacc
A0A8C5VCL0_BAD-01       gcagcccagcag--cagcag-ccaccatggaggagctgggcctgtggaga
A0A8C5YCP8_BIK-01       gtggccctgcggc-tagcct-tcattggggacgagatggacctg------
A0A8B7FTF7_HRK-01       --------------ctgcgc-tcgtc--cgccgcgcagctcacg--gccg
A0A8B7G497_BBC3-02      -cggtcctcagccctcgctc-tcgct--ggcagagcagcacctggagtcg
A0A8B7G497_BBC3-01      acggtcctcagccctcgctc-tcgct--ggcagagcagcacctggagtcg
A0A8B7G497_BBC3-03      acggtcctcagccctcgctc-tcgct--ggcagagcagcacctggagtcg
                                                                          

A0A8B7HMR3_PMAIP1-      gtgtg---------------------------------------------
A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      tctcgatcctccagtgggtatttctcttttgacacagacaggagcccagc
A0A8B7EUP7_BCL2L11      tctcgatcctccagtgggtatttctcttttgacacagacaggagcccagc
A0A8B7EUP7_BCL2L11      tctcgatcctccagtgggtatttctcttttgacacagacaggagcccagc
A0A8B7EUP7_BCL2L11      tctcgatcctccagtgggtatttctcttttgacacagacaggagcccagc
A0A8B7EUP7_BCL2L11      tctcgatcctccagtgggtatttctcttttgacacagacaggagcccagc
A0A8B7EUP7_BCL2L11      -----------------------------------agacaggagcccagc
A0A8C5UXV9_BMF-01       ctcag---------------------------------------cccagc
A0A8C5UXV9_BMF-02       ctcag---------------------------------------cccagc
A0A8C5UXV9_BMF-03       ctcag---------------------------------------cccagc
A0A8C5VCL0_BAD-01       cccggagcc---------------------gccacagctcgtaccccgcg
A0A8C5YCP8_BIK-01       --cgt---------------------------------------ctcagg
A0A8B7FTF7_HRK-01       cccgg---------------------------------------ctcaag
A0A8B7G497_BBC3-02      cccgt---------------------------------------ccccag
A0A8B7G497_BBC3-01      cccgt---------------------------------------ccccag
A0A8B7G497_BBC3-03      cccgt---------------------------------------ccccag
                                                                          

A0A8B7HMR3_PMAIP1-      -gcgttgggatgcaactacaatttttagctccttctctgctcttccctcc
A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      acccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccagg
A0A8B7EUP7_BCL2L11      acccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccagg
A0A8B7EUP7_BCL2L11      acccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccagg
A0A8B7EUP7_BCL2L11      acccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccagg
A0A8B7EUP7_BCL2L11      acccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccagg
A0A8B7EUP7_BCL2L11      acccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccagg
A0A8C5UXV9_BMF-01       ctccccgagccagggtgtcatgctgccttgt--ggggtgaccgaggaacc
A0A8C5UXV9_BMF-02       ctccccgagccagggtgtcatgctgccttgt--ggggtgaccgaggaacc
A0A8C5UXV9_BMF-03       ctccccgagccagggtgtcatgctgccttgt--ggggtgaccgaggaacc
A0A8C5VCL0_BAD-01       ggggcagag-gaggatgaagggatgga------ggaggaacccagcccct
A0A8C5YCP8_BIK-01       agcccc---------cgcctggcccgcctgcccggcatgaccatgcacag
A0A8B7FTF7_HRK-01       -gcgctggg------cgacgagctgcacc-----------------agcg
A0A8B7G497_BBC3-02      cgccccggg-ggccctggcgggcggtcccacccaggcggccccgggagtg
A0A8B7G497_BBC3-01      cgccccggg-ggccctggcgggcggtcccacccaggcggccccgggagtg
A0A8B7G497_BBC3-03      cgccccggg-ggccctggcgggcggtcccacccaggcggccccgggagtg
                                                                          

A0A8B7HMR3_PMAIP1-      tccttgcttacccttccccgggga--------------------------
A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      ccttcaacca--ttatctcagtgc--------------------------
A0A8B7EUP7_BCL2L11      ccttcaacca--ttatctcagtgc--------------------------
A0A8B7EUP7_BCL2L11      ccttcaacca--ttatctcagtgc--------------------------
A0A8B7EUP7_BCL2L11      ccttcaacca--ttatctcagtgc--------------------------
A0A8B7EUP7_BCL2L11      ccttcaacca--ttatctcagtgc--------------------------
A0A8B7EUP7_BCL2L11      ccttcaacca--ttatctcagtgc--------------------------
A0A8C5UXV9_BMF-01       ccagagactcttttatggcaatgctggctaccggcttcctctccctgcca
A0A8C5UXV9_BMF-02       ccagagactcttttatggcaatgctggctaccggcttcctctccctgcca
A0A8C5UXV9_BMF-03       ccagagactcttttatg---------------------------------
A0A8C5VCL0_BAD-01       tccggggccgctcacgctcggcgc--------------------------
A0A8C5YCP8_BIK-01       cctggggctg-------gcgctgt--------------------------
A0A8B7FTF7_HRK-01       caccatg-tg-------gcggcgc--------------------------
A0A8B7G497_BBC3-02      cgtgggg-ag-------gaggagc--------------------------
A0A8B7G497_BBC3-01      cgtgggg-ag-------gaggagc--------------------------
A0A8B7G497_BBC3-03      cgtgggg-ag-------gaggagc--------------------------
                                                                          

A0A8B7HMR3_PMAIP1-      -------------tgacatcacctcaggcaga------------------
A0A8B7HMR3_PMAIP1-      -----------------------------aga------------------
A0A8B7EUP7_BCL2L11      ------------------cttccatgaggcaatttcaggctgaacctgca
A0A8B7EUP7_BCL2L11      -------------aatggtt------------------------------
A0A8B7EUP7_BCL2L11      -------------aatggcttccatgaggcaatttcaggctgaacctgca
A0A8B7EUP7_BCL2L11      -------------aat----------------------------------
A0A8B7EUP7_BCL2L11      -------------aatggcttccatgaggcaatttcaggctgaacctgca
A0A8B7EUP7_BCL2L11      -------------aatggcttccatgaggcaatttcaggctgaacctgca
A0A8B7EUP7_BCL2L11      -------------aatggcttccatgaggcaatttcaggctgaacctgca
A0A8C5UXV9_BMF-01       gtttccctgcaggcttacctcttggggaacagcccgctgaagggcagtgg
A0A8C5UXV9_BMF-02       gtttccctgcaggcttacctcttggggaacagcccgctgaagggcagtgg
A0A8C5UXV9_BMF-03       --------------------------------------------------
A0A8C5VCL0_BAD-01       -------------cccccaacctctgggctgc------------------
A0A8C5YCP8_BIK-01       -------------cctacgaccagcgggttggctggggtgtgctcgggag
A0A8B7FTF7_HRK-01       -------------cgcgcg----------cgg------------------
A0A8B7G497_BBC3-02      -------------agtgggcccgggagatcgg------------------
A0A8B7G497_BBC3-01      -------------agtgggcccgggagatcgg------------------
A0A8B7G497_BBC3-03      -------------agtgggcccgggagatcgg------------------
                                                                          

A0A8B7HMR3_PMAIP1-      -----------------agaatgtgttcttcaactcaggagaatcggaga
A0A8B7HMR3_PMAIP1-      -----------------agaatgtgttcttcaactcaggagaatcggaga
A0A8B7EUP7_BCL2L11      gatatgcgcccggagatatggatcgcgcaggagttgcggcgtatcggaga
A0A8B7EUP7_BCL2L11      -----------agagaaataga------ggaagttgtcgtgtag------
A0A8B7EUP7_BCL2L11      gatatgcgcccggagatatggatcgcgcaggagttgcggcgtatcggaga
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      gatatgcgcccggagatatggatcgcgcaggagttgcggcgtatcggaga
A0A8B7EUP7_BCL2L11      gatatgcgcccggagatatggatcgcgcaggagttgcggcgtatcggaga
A0A8B7EUP7_BCL2L11      gatatgcgcccggagatatggatcgcgcaggagttgcggcgtatcggaga
A0A8C5UXV9_BMF-01       caacatcgagcagaggtacagattgcccgaaagcttcagtgcattgcaga
A0A8C5UXV9_BMF-02       caacatcgagcagaggtacagattgcccgaaagcttcagtgcattgcaga
A0A8C5UXV9_BMF-03       --------------------------------------------------
A0A8C5VCL0_BAD-01       -----aca---------gcgctatggccgcgagctccggaggatgagcga
A0A8C5YCP8_BIK-01       ccttagcg---------acggtttcgc--caccctcagggggaacgtggc
A0A8B7FTF7_HRK-01       ------------------------agc--cc----------gagggcgcc
A0A8B7G497_BBC3-02      ------------------------ggc--ccagctgcggcggatggcgga
A0A8B7G497_BBC3-01      ------------------------ggc--ccagctgcggcggatggcgga
A0A8B7G497_BBC3-03      ------------------------ggc--ccagctgcggcggatggcgga
                                                                          

A0A8B7HMR3_PMAIP1-      caaact------gcatttccagcaga--------------------aact
A0A8B7HMR3_PMAIP1-      caaact------gcatttccagcaga--------------------aact
A0A8B7EUP7_BCL2L11      tgagtttaacgcttattactcaaggagg------------------ctg-
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      tgagtttaacgcttattactcaaggagg------------------atgc
A0A8B7EUP7_BCL2L11      --------------------------gg------------------gtat
A0A8B7EUP7_BCL2L11      tgagtttaacgcttattactcaaggagg------------------gtat
A0A8B7EUP7_BCL2L11      tgagtttaacgcttattactcaaggagg------------------gtat
A0A8B7EUP7_BCL2L11      tgagtttaacgcttattactcaaggagg------------------gtat
A0A8C5UXV9_BMF-01       ccagttccaccggcttcacgtgcagcaac-----------------acca
A0A8C5UXV9_BMF-02       ccagttccaccggcttcacgtgcagcaac-----------------acca
A0A8C5UXV9_BMF-03       ----------------------------c-----------------acca
A0A8C5VCL0_BAD-01       cgagttcgaggactccttcaagaaggg-------------------actt
A0A8C5YCP8_BIK-01       caggttctggaggtccctc---------------------------agcc
A0A8B7FTF7_HRK-01       cgcgcccggcgcgctctcc---------------------------acct
A0A8B7G497_BBC3-02      cgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagagac
A0A8B7G497_BBC3-01      cgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagagac
A0A8B7G497_BBC3-03      cgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagagac
                                                                          

A0A8B7HMR3_PMAIP1-      actgaatttgatagt------------------------caaacttttcc
A0A8B7HMR3_PMAIP1-      actgaatttgatagt------------------------caaacttttcc
A0A8B7EUP7_BCL2L11      --------------------------------------------gcaaaa
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      ctct----------------------------------------------
A0A8B7EUP7_BCL2L11      ttttgaataa----------------------------------------
A0A8B7EUP7_BCL2L11      ttttgaataattaccaagcagacgaagaccaccctcaaatggttatcttg
A0A8B7EUP7_BCL2L11      ttttgaataattaccaagcagacgaagaccaccctcaaatggttatcttg
A0A8B7EUP7_BCL2L11      ttttgaataattaccaagcagacgaagaccaccctcaaatggttatcttg
A0A8C5UXV9_BMF-01       gcagaaccaaaatcgcgtgtggtggc----------------agatcctc
A0A8C5UXV9_BMF-02       gcagaaccaaaatcgcgtgtggtggc----------------agatcctc
A0A8C5UXV9_BMF-03       gcagaaccaaaatcgcgtgtggtggc----------------agatcctc
A0A8C5VCL0_BAD-01       cctcgcccgaagagcgcgggcacagcgacacagatacggcagagctccag
A0A8C5YCP8_BIK-01       ccaggccctgggtgtgccccggcggc---------ccggagcaggtgctg
A0A8B7FTF7_HRK-01       actggccctggctgtg----cgcggc---------cgcgca-agtggcgg
A0A8B7G497_BBC3-02      accgcccctcgccctg----gagggt---------cctgtacaatctcat
A0A8B7G497_BBC3-01      accgcccctcgccctg----gagggt---------cctgtacaatctcat
A0A8B7G497_BBC3-03      accgcccctcgccctg----gagggt---------cctgtacaatctcat
                                                                          

A0A8B7HMR3_PMAIP1-      gctcaggaacctgactgacttttcccaaagtaggtacaaatttcatcaat
A0A8B7HMR3_PMAIP1-      gctcaggaacctga------------------------------------
A0A8B7EUP7_BCL2L11      cgcctggtaccctccatc--------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      -------------------tccatctg-----------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      cgactgttacattacattgtccgcctgatatggag---------------
A0A8B7EUP7_BCL2L11      cgactgttacattacattgtccgcctgatatggag---------------
A0A8B7EUP7_BCL2L11      cgactgttacattacattgtccgcctgatatggag---------------
A0A8C5UXV9_BMF-01       ctcttcctacacaacctcgctttgaa----cggagaagagaacaggaacg
A0A8C5UXV9_BMF-02       ctcttcctacacaacctcgctttgaa----cggagaagagaacaggaacg
A0A8C5UXV9_BMF-03       ctcttcctacacaacctcgctttgaa----cggagaagagaacaggaacg
A0A8C5VCL0_BAD-01       ctggactcgcgtcattcagtcctggt------gggatcggaacgtgggca
A0A8C5YCP8_BIK-01       ctgctgctgctggtgctgctgctggg----cgggggcctgcacctgct--
A0A8B7FTF7_HRK-01       cgctggcggcctggct------------------gctcggcaggcgga--
A0A8B7G497_BBC3-02      catgggactcctgcccctacccaggggccacagagcccctgagatgga--
A0A8B7G497_BBC3-01      catgggactcctgcccctacccaggggccacagagcccctgagatgga--
A0A8B7G497_BBC3-03      catgggactcctgcccctacccaggggccacagagcccc---gatgga--
                                                                          

A0A8B7HMR3_PMAIP1-      tagaagacagatctcactgtaattga------------------------
A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      ---------------------attaa------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      ----------------gaggcattga------------------------
A0A8B7EUP7_BCL2L11      ----------------gaggcattga------------------------
A0A8B7EUP7_BCL2L11      ----------------gaggcattga------------------------
A0A8C5UXV9_BMF-01       gggcggg---------ccccaggtga------------------------
A0A8C5UXV9_BMF-02       gggcggg---------ccccaggtga------------------------
A0A8C5UXV9_BMF-03       gggcggg---------ccccag----------------------------
A0A8C5VCL0_BAD-01       ggggaggctccgccccctcccagtga------------------------
A0A8C5YCP8_BIK-01       ----------------gctcaagtga------------------------
A0A8B7FTF7_HRK-01       ----------------acttg--tag------------------------
A0A8B7G497_BBC3-02      ----------------gcccaattag------------------------
A0A8B7G497_BBC3-01      ----------------gcccaattag------------------------
A0A8B7G497_BBC3-03      ----------------gcccaattaggtgcctgcacccgcccggtggacg
                                                                          

A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7HMR3_PMAIP1-      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8C5UXV9_BMF-01       --------------------------------------------------
A0A8C5UXV9_BMF-02       --------------------------------------------------
A0A8C5UXV9_BMF-03       --------------------------------------------------
A0A8C5VCL0_BAD-01       --------------------------------------------------
A0A8C5YCP8_BIK-01       --------------------------------------------------
A0A8B7FTF7_HRK-01       --------------------------------------------------
A0A8B7G497_BBC3-02      --------------------------------------------------
A0A8B7G497_BBC3-01      --------------------------------------------------
A0A8B7G497_BBC3-03      tcggagacttggggggcaggaccctctcacctcctgacaccctggccagc
                                                                          

A0A8B7HMR3_PMAIP1-      ---------------------------
A0A8B7HMR3_PMAIP1-      ---------------------------
A0A8B7EUP7_BCL2L11      ---------------------------
A0A8B7EUP7_BCL2L11      ---------------------------
A0A8B7EUP7_BCL2L11      ---------------------------
A0A8B7EUP7_BCL2L11      ---------------------------
A0A8B7EUP7_BCL2L11      ---------------------------
A0A8B7EUP7_BCL2L11      ---------------------------
A0A8B7EUP7_BCL2L11      ---------------------------
A0A8C5UXV9_BMF-01       ---------------------------
A0A8C5UXV9_BMF-02       ---------------------------
A0A8C5UXV9_BMF-03       ---------------------------
A0A8C5VCL0_BAD-01       ---------------------------
A0A8C5YCP8_BIK-01       ---------------------------
A0A8B7FTF7_HRK-01       ---------------------------
A0A8B7G497_BBC3-02      ---------------------------
A0A8B7G497_BBC3-01      ---------------------------
A0A8B7G497_BBC3-03      acgggggactctttctgcaccatgtag
                                                   

© 1998-2022Legal notice