Dataset for CDS BMF of organism Microcebus murinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5UXV9_BMF-01      atggaaccatcccagtgtgtggaggagctggaggatgacgtgttccaacc
A0A8C5UXV9_BMF-02      atggaaccatcccagtgtgtggaggagctggaggatgacgtgttccaacc
A0A8C5UXV9_BMF-03      atggaaccatcccagtgtgtggaggagctggaggatgacgtgttccaacc
                       **************************************************

A0A8C5UXV9_BMF-01      agaggatggggagtcggggacccagcccggaagcgtgctctctgctgacc
A0A8C5UXV9_BMF-02      agaggatggggagtcggggacccagcccggaagcgtgctctctgctgacc
A0A8C5UXV9_BMF-03      agaggatggggagtcggggacccagcccggaagcgtgctctctgctgacc
                       **************************************************

A0A8C5UXV9_BMF-01      tgtttgcccagagccagctggactgccccctcagccggcttcagctcttc
A0A8C5UXV9_BMF-02      tgtttgcccagagccagctggactgccccctcagccggcttcagctcttc
A0A8C5UXV9_BMF-03      tgtttgcccagagccagctggactgccccctcagccggcttcagctcttc
                       **************************************************

A0A8C5UXV9_BMF-01      cctctcacccactgctgtggccctgggcttcgacccaccagccaggaaga
A0A8C5UXV9_BMF-02      cctctcacccactgctgtggccctgggcttcgacccaccagccaggaaga
A0A8C5UXV9_BMF-03      cctctcacccactgctgtggccctgggcttcgacccaccagccaggaaga
                       **************************************************

A0A8C5UXV9_BMF-01      caaggccacccagaccctcagcccagcctccccgagccagggtgtcatgc
A0A8C5UXV9_BMF-02      caaggccacccagaccctcagcccagcctccccgagccagggtgtcatgc
A0A8C5UXV9_BMF-03      caaggccacccagaccctcagcccagcctccccgagccagggtgtcatgc
                       **************************************************

A0A8C5UXV9_BMF-01      tgccttgtggggtgaccgaggaaccccagagactcttttatggcaatgct
A0A8C5UXV9_BMF-02      tgccttgtggggtgaccgaggaaccccagagactcttttatggcaatgct
A0A8C5UXV9_BMF-03      tgccttgtggggtgaccgaggaaccccagagactcttttatg--------
                       ******************************************        

A0A8C5UXV9_BMF-01      ggctaccggcttcctctccctgccagtttccctgcaggcttacctcttgg
A0A8C5UXV9_BMF-02      ggctaccggcttcctctccctgccagtttccctgcaggcttacctcttgg
A0A8C5UXV9_BMF-03      --------------------------------------------------
                                                                         

A0A8C5UXV9_BMF-01      ggaacagcccgctgaagggcagtggcaacatcgagcagaggtacagattg
A0A8C5UXV9_BMF-02      ggaacagcccgctgaagggcagtggcaacatcgagcagaggtacagattg
A0A8C5UXV9_BMF-03      --------------------------------------------------
                                                                         

A0A8C5UXV9_BMF-01      cccgaaagcttcagtgcattgcagaccagttccaccggcttcacgtgcag
A0A8C5UXV9_BMF-02      cccgaaagcttcagtgcattgcagaccagttccaccggcttcacgtgcag
A0A8C5UXV9_BMF-03      --------------------------------------------------
                                                                         

A0A8C5UXV9_BMF-01      caacaccagcagaaccaaaatcgcgtgtggtggcagatcctcctcttcct
A0A8C5UXV9_BMF-02      caacaccagcagaaccaaaatcgcgtgtggtggcagatcctcctcttcct
A0A8C5UXV9_BMF-03      ---caccagcagaaccaaaatcgcgtgtggtggcagatcctcctcttcct
                          ***********************************************

A0A8C5UXV9_BMF-01      acacaacctcgctttgaacggagaagagaacaggaacggggcgggcccca
A0A8C5UXV9_BMF-02      acacaacctcgctttgaacggagaagagaacaggaacggggcgggcccca
A0A8C5UXV9_BMF-03      acacaacctcgctttgaacggagaagagaacaggaacggggcgggcccca
                       **************************************************

A0A8C5UXV9_BMF-01      ggtga
A0A8C5UXV9_BMF-02      ggtga
A0A8C5UXV9_BMF-03      g----
                       *    

© 1998-2022Legal notice