Dataset for CDS BCL2L11 of organism Microcebus murinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B7EUP7_BCL2L11      atggcaaagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
A0A8B7EUP7_BCL2L11      atggcaaagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
A0A8B7EUP7_BCL2L11      atggcaaagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
A0A8B7EUP7_BCL2L11      atggcaaagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
A0A8B7EUP7_BCL2L11      atggcaaagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
A0A8B7EUP7_BCL2L11      atggcaaagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
A0A8B7EUP7_BCL2L11      atggcaaagcaaccttctgatgtaggttctgagtgtgaccaagaaggtgg
                        **************************************************

A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggcctggggccccta
A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggcctggggccccta
A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggcctggggccccta
A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggcctggggccccta
A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggcctggggccccta
A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggcctggggccccta
A0A8B7EUP7_BCL2L11      acagttgcaacctgtggagagaccgccccagctcaggcctggggccccta
                        **************************************************

A0A8B7EUP7_BCL2L11      cctccctacagacagagccccaag--------------------------
A0A8B7EUP7_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A8B7EUP7_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A8B7EUP7_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A8B7EUP7_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A8B7EUP7_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A8B7EUP7_BCL2L11      cctccctacagacagagcccca----------------------------
                        **********************                            

A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccgctggccccacc
A0A8B7EUP7_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccgctggccccacc
A0A8B7EUP7_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccgctggccccacc
A0A8B7EUP7_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccgctggccccacc
A0A8B7EUP7_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccgctggccccacc
A0A8B7EUP7_BCL2L11      --------------------------------------------------
                                                                          

A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A8B7EUP7_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A8B7EUP7_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A8B7EUP7_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A8B7EUP7_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A8B7EUP7_BCL2L11      --------------------------------------------------
                                                                          

A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8B7EUP7_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8B7EUP7_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8B7EUP7_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8B7EUP7_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8B7EUP7_BCL2L11      --------------------------------------------------
                                                                          

A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A8B7EUP7_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A8B7EUP7_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A8B7EUP7_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A8B7EUP7_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A8B7EUP7_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                                                                          

A0A8B7EUP7_BCL2L11      --------------------------------------------cttcca
A0A8B7EUP7_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggtt----
A0A8B7EUP7_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
A0A8B7EUP7_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaat--------
A0A8B7EUP7_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
A0A8B7EUP7_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
A0A8B7EUP7_BCL2L11      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
                                                                          

A0A8B7EUP7_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
A0A8B7EUP7_BCL2L11      -------------------------------------agagaaataga--
A0A8B7EUP7_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
A0A8B7EUP7_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
A0A8B7EUP7_BCL2L11      tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatc
                                                                          

A0A8B7EUP7_BCL2L11      gcgcaggagttgcggcgtatcggagatgagtttaacgcttattactcaag
A0A8B7EUP7_BCL2L11      ----ggaagttgtcgtgtag------------------------------
A0A8B7EUP7_BCL2L11      gcgcaggagttgcggcgtatcggagatgagtttaacgcttattactcaag
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      gcgcaggagttgcggcgtatcggagatgagtttaacgcttattactcaag
A0A8B7EUP7_BCL2L11      gcgcaggagttgcggcgtatcggagatgagtttaacgcttattactcaag
A0A8B7EUP7_BCL2L11      gcgcaggagttgcggcgtatcggagatgagtttaacgcttattactcaag
                                                                          

A0A8B7EUP7_BCL2L11      gaggctg-------------------------------------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      gaggatgcctct--------------------------------------
A0A8B7EUP7_BCL2L11      --gggtatttttgaataa--------------------------------
A0A8B7EUP7_BCL2L11      gagggtatttttgaataattaccaagcagacgaagaccaccctcaaatgg
A0A8B7EUP7_BCL2L11      gagggtatttttgaataattaccaagcagacgaagaccaccctcaaatgg
A0A8B7EUP7_BCL2L11      gagggtatttttgaataattaccaagcagacgaagaccaccctcaaatgg
                                                                          

A0A8B7EUP7_BCL2L11      ---------gcaaaacgcctggtaccctccatc-----------------
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      ---------------------------tccatctg-------------at
A0A8B7EUP7_BCL2L11      --------------------------------------------------
A0A8B7EUP7_BCL2L11      ttatcttgcgactgttacattacattgtccgcctgatatggaggaggcat
A0A8B7EUP7_BCL2L11      ttatcttgcgactgttacattacattgtccgcctgatatggaggaggcat
A0A8B7EUP7_BCL2L11      ttatcttgcgactgttacattacattgtccgcctgatatggaggaggcat
                                                                          

A0A8B7EUP7_BCL2L11      ---
A0A8B7EUP7_BCL2L11      ---
A0A8B7EUP7_BCL2L11      taa
A0A8B7EUP7_BCL2L11      ---
A0A8B7EUP7_BCL2L11      tga
A0A8B7EUP7_BCL2L11      tga
A0A8B7EUP7_BCL2L11      tga
                           

© 1998-2022Legal notice