Dataset for CDS BMF of organism Maylandia zebra

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P9DPJ5_BMF-02      atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcg
A0A3P9DPJ5_BMF-01      atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcg

A0A3P9DPJ5_BMF-02      caccacattcagggagataaagtgtgaacatcgaggcacacagacacccg
A0A3P9DPJ5_BMF-01      caccacattcagggagataaagtgtgaacatcgaggcacacagacacccg

A0A3P9DPJ5_BMF-02      gtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagag
A0A3P9DPJ5_BMF-01      gtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagag

A0A3P9DPJ5_BMF-02      gagcccagaccactcttctacggtaacgcaggttttcgattgcacttccc
A0A3P9DPJ5_BMF-01      gagcccagaccactcttctacggtaacgcaggttttcgattgcacttccc

A0A3P9DPJ5_BMF-02      ggcacgcttcgagctcgtcggggatcacagagcgagtcgacaaggaagca
A0A3P9DPJ5_BMF-01      ggcacgcttcgagctcgtcggggatcacagagcgagtcgacaaggaagca

A0A3P9DPJ5_BMF-02      cggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggct
A0A3P9DPJ5_BMF-01      cggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggct

A0A3P9DPJ5_BMF-02      cgcagcgtggaggcctgcattggacagaaactccagctcataggagacca
A0A3P9DPJ5_BMF-01      cgcagcgtggaggcctgcattggacagaaactccagctcataggagacca

A0A3P9DPJ5_BMF-02      gtttcactgggaacgcctgcaactgtatcaccgaaaccaaaggaaccagg
A0A3P9DPJ5_BMF-01      gtttcactgggaacgcctgcaactgtatcaccgaaaccaaaggaaccagg

A0A3P9DPJ5_BMF-02      ggccgatgtggtggcgcctggccgcggccattctcagccttctgtttgat
A0A3P9DPJ5_BMF-01      ggccgatgtggtggcgcctggccgcggccattctcagccttctgtttgat

A0A3P9DPJ5_BMF-02      agggggttcatagccggaggagggggtggaggacggaggtga
A0A3P9DPJ5_BMF-01      agggggttcatagccggaggagggggtggaggacggaggtga

© 1998-2020Legal notice