Dataset for CDS classical BH3-containing proteins of organism Mastacembelus armatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q3SYA1_BCL2L11      atggcaacagaggagagcggagatccaccagccggtgatcccagagtctc
A0A3Q3RXS8_BAD-01       atggctgc-----aaaattcag-tatttcagaaa--g-----cgaatca-
A0A3Q3RVI2_BMF-01       atggacgatgaggaggatgatg-tgtttgagcca--gacccccacttct-
A0A3Q3RVI2_BMF-02       atggacgatgaggaggatgatg-tgtttgagcca--gacccccacttct-
                        ****         *       * *     **     *         **  

A0A3Q3SYA1_BCL2L11      ggcgcaaacctcccgttcgaacggcggcaccgaccagagctccg------
A0A3Q3RXS8_BAD-01       gactca----tca-----ga--ggaggtagagggaggaaaacagaagaag
A0A3Q3RVI2_BMF-01       ggcgca----ccacgttcag--ggagataaagtgtgaagaccggggcaca
A0A3Q3RVI2_BMF-02       ggcgca----ccacgttcag--ggagataaagtgtgaagaccggggcaca
                        * * **     *          ** *  *  *     *   * *      

A0A3Q3SYA1_BCL2L11      -----------------------------------------tctcgccgt
A0A3Q3RXS8_BAD-01       tcgtcagcaaggcaagagcaacaggtttctcagcgccacgcccttgcctt
A0A3Q3RVI2_BMF-01       cagaca-----------------------------------cctggccct
A0A3Q3RVI2_BMF-02       cagaca-----------------------------------cctggccct
                                                                  ** *** *

A0A3Q3SYA1_BCL2L11      cccgaggcagaaccagatccattgc---ccatctcgacagcctaagc---
A0A3Q3RXS8_BAD-01       acctgagct----cagaacaacagcctccaatcgaatcaggctgagttcg
A0A3Q3RVI2_BMF-01       gccttggcg----ctgaacaacggcatgctgcc--------ctg----tg
A0A3Q3RVI2_BMF-02       gccttggcg----ctgaacaacggcatgctgcc--------ctg----tg
                         **   **     * ** * *  **   *   *        **       

A0A3Q3SYA1_BCL2L11      gtgtttca-------------cacgaggtcaatattccagcttcctcgcc
A0A3Q3RXS8_BAD-01       gagtcccagtccagggtggatgaggaggctggt---------------ac
A0A3Q3RVI2_BMF-01       gagtcgca-------------gaggagccaaga---------------cc
A0A3Q3RVI2_BMF-02       gagtcgca-------------gaggagccaaga---------------cc
                        * **  **              * ***                      *

A0A3Q3SYA1_BCL2L11      gctcctctagtggatatttctcctccgacggcgactcgctgccgagttcc
A0A3Q3RXS8_BAD-01       gcccacagacggag----ctccatttaggggaaggtccaagtcagctccc
A0A3Q3RVI2_BMF-01       actcttctacgg-------------caacgcaggttttcgattgcacttc
A0A3Q3RVI2_BMF-02       actcttctacgg-------------caacgcaggttttcgattgcacttc
                         * *    *  *                 *     *             *

A0A3Q3SYA1_BCL2L11      cct-ctctccccgaggccggtgacagctgacaa-----------------
A0A3Q3RXS8_BAD-01       cctgctc----------tgtgggcagccaagaaatatggcc---------
A0A3Q3RVI2_BMF-01       ccggcacattttgaacttgttggggatcaggaagtgaggcaacaagaaag
A0A3Q3RVI2_BMF-02       ccggcacattttgaacttgttggggatcaggaagtgaggcaacaagaaag
                        **  * *           *  *         **                 

A0A3Q3SYA1_BCL2L11      --------agccacgcagactccgagcctcacgagccaggtgatgaacca
A0A3Q3RXS8_BAD-01       -----agcagctccgaaggat--gagc--gatgagtttgac-----agc-
A0A3Q3RVI2_BMF-01       agaagaggagcaaaacaggat-ggagc--agctacccaggc-----agca
A0A3Q3RVI2_BMF-02       agaagaggagcaaaacaggat-ggagc--agctacccaggc-----agca
                                ***     **  *  ****      *    *       * * 

A0A3Q3SYA1_BCL2L11      cgccctgcagcgcctggctgaagcgcacggcgg--aggagctggagcgca
A0A3Q3RXS8_BAD-01       ----ctcctggataaaggggaaatgag----agtgaggaat----gctgg
A0A3Q3RVI2_BMF-01       acctctcgtgcacagtgtggaggcgtgtattggccagaaactccagctga
A0A3Q3RVI2_BMF-02       acctctcgtgcacagtgtggaggcgtgtattggccagaaactccagctga
                            **   *      *  **   *       *  ** *      **   

A0A3Q3SYA1_BCL2L11      ccggcagc-------atggtgagcacaaacacctacg-------------
A0A3Q3RXS8_BAD-01       caag-----------gcccaaaagatgcaccactcta-------------
A0A3Q3RVI2_BMF-01       taggagaccaatttcaccgagaacacttgcaactgcaggttggctgggcg
A0A3Q3RVI2_BMF-02       taggagaccaatttcaccgagaacacttgcaactgta--tcatctaaacc
                           *                 *  *    *  **                

A0A3Q3SYA1_BCL2L11      --------------tagtcg--------------------cttattcact
A0A3Q3RXS8_BAD-01       ----aaacctggtggagcta--------------------cctctttagt
A0A3Q3RVI2_BMF-01       ccagagacgtcaggcagtt-------tgcctg--------tcttgttagc
A0A3Q3RVI2_BMF-02       aaaggaaccaggggctgctgtggtggcgcctggccacagctctgctcagc
                                        *                         *  * *  

A0A3Q3SYA1_BCL2L11      ------------------gcccatgctgaatacacgcaggtaaagcagcc
A0A3Q3RXS8_BAD-01       ----------------------taccaggagacagatggagaaaacaacc
A0A3Q3RVI2_BMF-01       ---atgcctcacc-----ttgataacaggag---tgtggagagaggga--
A0A3Q3RVI2_BMF-02       ctactgtttgacagagggttcattgctggag---gaggcagagcaggacg
                                                 * * *           *        

A0A3Q3SYA1_BCL2L11      t---taa-------------------------
A0A3Q3RXS8_BAD-01       tccatgaaaaccacacaccccgcacagagtag
A0A3Q3RVI2_BMF-01       ----tga-------------------------
A0A3Q3RVI2_BMF-02       gaggtga-------------------------
                            * *                         

© 1998-2022Legal notice