Dataset for CDS classical BH3-containing proteins of organism Marmota marmota marmota

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5YUG6_PMAIP1-      atgc-------------------------------ctgg-----------
A0A8C6A7B1_PMAIP1-      atgc-------------------------------ctgg-----------
A0A8C5Z4I8_BAD-01       atgtt------ccagat------------------ccca---gagtttga
A0A8C6A5T3_BMF-01       gttttcccagaggagatggagccgc----------ctca-gtgtgtggag
A0A8C5YPB3_BIK-01       atgctggccaaccaggtggccctacga--------ctggcctgcattggg
A0A8C5YNZ8_BCL2L11      atg-------gcaaagcaaccttccgatgtaagttctga---gtgtgaca
A0A8C5YNZ8_BCL2L11      atg-------gcaaagcaaccttccgatgtaagttctga---gtgtgaca
                         *                                 *              

A0A8C5YUG6_PMAIP1-      ------aaagaagggg----------tggaagaatgagc---agctgacc
A0A8C6A7B1_PMAIP1-      ------aaagaaagtg----------agtaagcatgcactcaacccaaca
A0A8C5Z4I8_BAD-01       gcccagtgagcaggaagactccagctccgcagaagggggcctgg--gccc
A0A8C6A5T3_BMF-01       gagctggaagatgatgtgttccagc-cagaggatggggagccag-ggacc
A0A8C5YPB3_BIK-01       ga----tgagatggatctgtgtttt-c------ggggcctccaactggcc
A0A8C5YNZ8_BCL2L11      ga----gaaggtggacaattgcagc-ctgcagagaggcctc-------cc
A0A8C5YNZ8_BCL2L11      ga----gaaggtggacaattgcagc-ctgcagagaggcctc-------cc
                                **                         *            * 

A0A8C5YUG6_PMAIP1-      ccagtgaccccagcag----------------------tggaacttgagt
A0A8C6A7B1_PMAIP1-      caggtgtcagcagagg----------------------ttgaaactgag-
A0A8C5Z4I8_BAD-01       cagccccg-cagggga------------ccggccaggcccctacaagaat
A0A8C6A5T3_BMF-01       cag------cctgggagcttgctctctgctgacttgtttgc--ccagagc
A0A8C5YPB3_BIK-01       cagctc---cctggga--tggccatgcacagccttgccctcagctacagc
A0A8C5YNZ8_BCL2L11      cagctcaggccggggg--ccccta--------cctcccttcagacagagc
A0A8C5YNZ8_BCL2L11      cagctcaggccggggg--ccccta--------cctcccttcagacagagc
                        *           *                                  *  

A0A8C5YUG6_PMAIP1-      c-------------------------------------------------
A0A8C6A7B1_PMAIP1-      --------------------------------------------------
A0A8C5Z4I8_BAD-01       c---------------------------------aaccaccaggctgcgg
A0A8C6A5T3_BMF-01       c--------------------agctggactgccccctcagcaggcttcag
A0A8C5YPB3_BIK-01       c-------------------------------------------------
A0A8C5YNZ8_BCL2L11      ctcaaggtaatcccgaaggcgaaggggaccgctgcccccacggcagccca
A0A8C5YNZ8_BCL2L11      ctca----------------------------------------------
                                                                          

A0A8C5YUG6_PMAIP1-      --------------------------------------------------
A0A8C6A7B1_PMAIP1-      --------------------------------------------------
A0A8C5Z4I8_BAD-01       cttggctccaggcctc----------cccagggacaccggtcaccagcag
A0A8C6A5T3_BMF-01       ctcttccctctcacccactgctgtggtcctgggcttcgacctacc-----
A0A8C5YPB3_BIK-01       --------------------------------------------------
A0A8C5YNZ8_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A8C5YNZ8_BCL2L11      --------------------------------------------------
                                                                          

A0A8C5YUG6_PMAIP1-      --------------------------------------------------
A0A8C6A7B1_PMAIP1-      --------------------------------------------------
A0A8C5Z4I8_BAD-01       --------------------------------------------------
A0A8C6A5T3_BMF-01       --------------------------------------------------
A0A8C5YPB3_BIK-01       --------------------------------------------------
A0A8C5YNZ8_BCL2L11      cccgcttttcatctttgtgagaagatcttccctgctgtctcgatcctcca
A0A8C5YNZ8_BCL2L11      --------------------------------------------------
                                                                          

A0A8C5YUG6_PMAIP1-      ----------------------tggcat---tc-----------------
A0A8C6A7B1_PMAIP1-      -----------------------ggcatgtctc-----------------
A0A8C5Z4I8_BAD-01       ----------------------cggcaggcaaccagcagcagcaaccatg
A0A8C6A5T3_BMF-01       ----------------------agccaggaa-------------------
A0A8C5YPB3_BIK-01       ----------------------aggcaagagtc-----------------
A0A8C5YNZ8_BCL2L11      gtgggtatttctcttttgacacagacaggagcccagcacccatgagttgt
A0A8C5YNZ8_BCL2L11      ----------------------agacaggagcccagcacccatgagttgt
                                               * **                       

A0A8C5YUG6_PMAIP1-      --------------------------------------------------
A0A8C6A7B1_PMAIP1-      --------------------------------------------------
A0A8C5Z4I8_BAD-01       gaggcgctggggctacggagacccggagtcgccacagctcgtaccccgca
A0A8C6A5T3_BMF-01       ga-----caaggccactcagaccctcagcccagcctccccaagccagggt
A0A8C5YPB3_BIK-01       -a-----cgggtgtgctcaga-----------------------------
A0A8C5YNZ8_BCL2L11      ga-----caaatcaacacaaaccccaagtcctccttgcc-----------
A0A8C5YNZ8_BCL2L11      ga-----caaatcaacacaaaccccaagtcctccttgcc-----------
                                                                          

A0A8C5YUG6_PMAIP1-      --------------------------------------------------
A0A8C6A7B1_PMAIP1-      --------------------------------------------------
A0A8C5Z4I8_BAD-01       gataccgatttggatgaagagatggaagaggagcccagccccttccgcgg
A0A8C6A5T3_BMF-01       gtcatgctgccttgtggagtgactgaagaa-----------ccccagcga
A0A8C5YPB3_BIK-01       ----------------------------ag-----------cttgaccca
A0A8C5YNZ8_BCL2L11      --------------------------aggc-----------cttcaacca
A0A8C5YNZ8_BCL2L11      --------------------------aggc-----------cttcaacca
                                                                          

A0A8C5YUG6_PMAIP1-      --------------------------------------------------
A0A8C6A7B1_PMAIP1-      --------------------------------------------------
A0A8C5Z4I8_BAD-01       ccgctcgcgctcggcg--------------------ccccccaatctctg
A0A8C6A5T3_BMF-01       ctcttttatggcaatgctggctaccggcttcctctccctgctagtttc--
A0A8C5YPB3_BIK-01       gggtct--------------------------------cgccagcctcag
A0A8C5YNZ8_BCL2L11      ttatctgagtgcaatg-------------gcttccatgcggcagtctcag
A0A8C5YNZ8_BCL2L11      ttatctgagtgcaatg-------------gcttccatgcggcagtctcag
                                                                          

A0A8C5YUG6_PMAIP1-      --------------------------------------------------
A0A8C6A7B1_PMAIP1-      --------------------------------------------------
A0A8C5Z4I8_BAD-01       gg-----ctgca--------------------------------------
A0A8C6A5T3_BMF-01       ------cctgcaggcttgccccttggagagcagccccctgaaggtcagtg
A0A8C5YPB3_BIK-01       ggagaacatg------tggttc----------------------------
A0A8C5YNZ8_BCL2L11      gcagaacctgcagacatgcgcc----------------------------
A0A8C5YNZ8_BCL2L11      gcagaacctgcagacatgcgcc----------------------------
                                                                          

A0A8C5YUG6_PMAIP1-      --------------------------------aactcaggagatttggag
A0A8C6A7B1_PMAIP1-      --------------------------------aactcaggagatttggag
A0A8C5Z4I8_BAD-01       -----------cagcgctacgg-----ccgcgagctccggaggatgagcg
A0A8C6A5T3_BMF-01       gcaacatcgagcagaggtacagatcgcccgaaaacttcagtgcattgcag
A0A8C5YPB3_BIK-01       -----------tggagacccacggcccccagcacccg------------g
A0A8C5YNZ8_BCL2L11      -----------cggagatctggatcgcgcaggagctgcggcgaattggag
A0A8C5YNZ8_BCL2L11      -----------cggagatctggatcgcgcaggagctgcggcgaattggag
                                                        * *              *

A0A8C5YUG6_PMAIP1-      acaaagt-------------------aaatttccgtcagaaacttctgaa
A0A8C6A7B1_PMAIP1-      ataaact-------------------gaatttccataagaaacttctgaa
A0A8C5Z4I8_BAD-01       acgaatt----------------cgagggctcctttaagggacttcctcg
A0A8C6A5T3_BMF-01       accagttccaccggcttcatatgcag-----------caacaccaacaga
A0A8C5YPB3_BIK-01       gtgcctcctgcccg---ggcctgccgggag--------------------
A0A8C5YNZ8_BCL2L11      atgagtttaacctgtattacccacggagggtattttttaataattaccaa
A0A8C5YNZ8_BCL2L11      atgagtttaacctgtattacccacggagggtattttttaataattaccaa
                                                                          

A0A8C5YUG6_PMAIP1-      tttgatttccaaac------------------------------------
A0A8C6A7B1_PMAIP1-      tttgattttcagac------------------------------------
A0A8C5Z4I8_BAD-01       cccgaggagcgcgggcacagcgtcgcagatgcggcaaagctccagctgga
A0A8C6A5T3_BMF-01       accgaa-atcgtgtgtg----gtggcagattc------------------
A0A8C5YPB3_BIK-01       -ctgctgcccgtgc---------tgctgctgc------------------
A0A8C5YNZ8_BCL2L11      cctgaagaccaccccca----aatggttatct------------------
A0A8C5YNZ8_BCL2L11      cctgaagaccaccccca----aatggttatct------------------
                           *     *                                        

A0A8C5YUG6_PMAIP1-      -------------------------tcttcagtttag-------------
A0A8C6A7B1_PMAIP1-      -------------------------ccttcagt-----------------
A0A8C5Z4I8_BAD-01       cgcgcttcatccagtcctggtgggatcggaacttggg--gaggcgaggct
A0A8C6A5T3_BMF-01       tcctcttcctgcacaacctgg----ccttaaatggagatgagaacaggga
A0A8C5YPB3_BIK-01       tgggcctgttgctgagcagggc---cctgtacctgcg-------------
A0A8C5YNZ8_BCL2L11      tgcgcctgttgcgttgcatcatccgcctggtgtggag-------------
A0A8C5YNZ8_BCL2L11      tgcgcctgttgcgttgcatcatccgcctggtgtggag-------------
                                                  *                       

A0A8C5YUG6_PMAIP1-      -----------taacctga
A0A8C6A7B1_PMAIP1-      ----------------tga
A0A8C5Z4I8_BAD-01       ccgccccctccc--agtga
A0A8C6A5T3_BMF-01       ccgggcaggtcctaggtga
A0A8C5YPB3_BIK-01       -------gctcc--agtga
A0A8C5YNZ8_BCL2L11      -------gatgc--actga
A0A8C5YNZ8_BCL2L11      -------gatgc--actga
                                        ***

© 1998-2022Legal notice