Dataset for CDS classical BH3-containing proteins of organism Marmota marmota marmota

[Download (right click)] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A8C5YUG6_PMAIP1-01       atgcctggaaagaagggg--------------------------------
A0A8C6A7B1_PMAIP1-01       atgcctggaaagaaagtg--------------------------------
A0A8C5Z4I8_BAD-01          atgttc---cag-----atcccag----agtttga------gcccagtga
A0A8C5YPB3_BIK-01          atgctggccaaccaggtggccctacgact----ggcctgcat--tgggga
A0A8C5YNZ8_BCL2L11-01      atgg---caaag-----caaccttccgatgtaagttctgagtgtgacaga
A0A8C5YNZ8_BCL2L11-02      atgg---caaag-----caaccttccgatgtaagttctgagtgtgacaga
A0A8C6A5T3_BMF-01          gttttcccagaggagatggagccgcctcag-----tgtgtggaggagctg
                            *        *                                       

A0A8C5YUG6_PMAIP1-01       -----tggaaga-------at-gagc------------------------
A0A8C6A7B1_PMAIP1-01       -----agtaagc-------at-gcac------------------------
A0A8C5Z4I8_BAD-01          gcaggaagac---tccagctccgcaga-agggggcctgggccccagcccc
A0A8C5YPB3_BIK-01          tgag----------------------------------------------
A0A8C5YNZ8_BCL2L11-01      gaaggtggacaattgcagcct-gcagagaggcctccccagctcaggccgg
A0A8C5YNZ8_BCL2L11-02      gaaggtggacaattgcagcct-gcagagaggcctccccagctcaggccgg
A0A8C6A5T3_BMF-01          gaagatgatgtgttccagcca-gaggatggggagccagggacccagcctg
                                                                             

A0A8C5YUG6_PMAIP1-01       --------------------------------------------------
A0A8C6A7B1_PMAIP1-01       --------------------------------------------------
A0A8C5Z4I8_BAD-01          gcaggggaccggccaggcccctacaagaatcaaccaccaggctgcggctt
A0A8C5YPB3_BIK-01          --------------------------------------------------
A0A8C5YNZ8_BCL2L11-01      ------gggcccctacctcccttca-gacagagcctcaaggtaatcccga
A0A8C5YNZ8_BCL2L11-02      ------gggcccctacctcccttca-gacagagcctcaa-----------
A0A8C6A5T3_BMF-01          ------ggagc--ttgctctctgct-gacttg----------tttgccca
                                                                             

A0A8C5YUG6_PMAIP1-01       --------------------------------------------------
A0A8C6A7B1_PMAIP1-01       --------------------------------------------------
A0A8C5Z4I8_BAD-01          ggctccaggcctccccagggac--------------------accggtca
A0A8C5YPB3_BIK-01          -------atggatctgtgttttcggggcctccaactggc---ccagctcc
A0A8C5YNZ8_BCL2L11-01      aggcgaaggggaccgctgcccccacggcagcccacaggg---cccgctgg
A0A8C5YNZ8_BCL2L11-02      --------------------------------------------------
A0A8C6A5T3_BMF-01          gagccagctgga---ctgccccctcagcaggcttcagctcttccctctca
                                                                             

A0A8C5YUG6_PMAIP1-01       ------------------------------agct---------------g
A0A8C6A7B1_PMAIP1-01       ---------------------------tcaaccc---------------a
A0A8C5Z4I8_BAD-01          ccagcagcggcaggcaaccagcag----cagcaa---cca-tg--gagg-
A0A8C5YPB3_BIK-01          ctgggatggccatgcacagccttgccctcagctacagccaggc--aagag
A0A8C5YNZ8_BCL2L11-01      ccccaccggccagccctggccctt----ttgcta---cca-gatccccgc
A0A8C5YNZ8_BCL2L11-02      --------------------------------------------------
A0A8C6A5T3_BMF-01          cccactgctgtggtcctgggcttc----gaccta---cca-gc--cagga
                                                                             

A0A8C5YUG6_PMAIP1-01       accccagtgaccccagcag-------------------------------
A0A8C6A7B1_PMAIP1-01       acacaggtgtcagcagagg-------------------------------
A0A8C5Z4I8_BAD-01          cgctggggctacggagacccggagtcgccac---agctcgtaccccgcag
A0A8C5YPB3_BIK-01          tcacgggtgtgctcagaagcttgacccaggg---tc--------------
A0A8C5YNZ8_BCL2L11-01      ttttcatctttgtgagaagatcttccctgctgtctcgatcctccagtggg
A0A8C5YNZ8_BCL2L11-02      --------------------------------------------------
A0A8C6A5T3_BMF-01          agacaaggccactcagaccctcagcccagcc---tccccaagccagggtg
                                                                             

A0A8C5YUG6_PMAIP1-01       --------------------------------------------------
A0A8C6A7B1_PMAIP1-01       --------------------------------------------------
A0A8C5Z4I8_BAD-01          ataccgatttggatgaagagatggaagaggagcccagccccttccgcggc
A0A8C5YPB3_BIK-01          --------------------------------------------------
A0A8C5YNZ8_BCL2L11-01      tatttctctttt-gacacagacaggagcccagcacccatgagttgtgaca
A0A8C5YNZ8_BCL2L11-02      -------------------gacaggagcccagcacccatgagttgtgaca
A0A8C6A5T3_BMF-01          tcatgctgccttgtggagtgactgaagaaccccagcgactcttttatggc
                                                                             

A0A8C5YUG6_PMAIP1-01       --------------------------------------------------
A0A8C6A7B1_PMAIP1-01       --------------------------------------------------
A0A8C5Z4I8_BAD-01          cgctc--gcgctcggc-------------------gccccccaatctctg
A0A8C5YPB3_BIK-01          --------------------------------------------------
A0A8C5YNZ8_BCL2L11-01      aatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctg
A0A8C5YNZ8_BCL2L11-02      aatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctg
A0A8C6A5T3_BMF-01          aatgctggctaccggcttcctctccctgctagtt----------tccctg
                                                                             

A0A8C5YUG6_PMAIP1-01       --------------------------------tggaacttgagtctggc-
A0A8C6A7B1_PMAIP1-01       --------------------------------ttgaaactgagggcatg-
A0A8C5Z4I8_BAD-01          ggctgca-cagcgctacggccgcgagctccg-------------------
A0A8C5YPB3_BIK-01          ------------------tcgccagcctcagggagaacatgtggttctgg
A0A8C5YNZ8_BCL2L11-01      agt-gcaatggcttccatgcggcagtctcaggcagaacctgcagacatgc
A0A8C5YNZ8_BCL2L11-02      agt-gcaatggcttccatgcggcagtctcaggcagaacctgcagacatgc
A0A8C6A5T3_BMF-01          cag-gct-tgccccttggagagcagccccctgaaggtcagtggcaacatc
                                                                             

A0A8C5YUG6_PMAIP1-01       ---------------------attcaactcaggagatttggagacaaagt
A0A8C6A7B1_PMAIP1-01       ---------------------tctcaactcaggagatttggagataaact
A0A8C5Z4I8_BAD-01          ---------------------gaggatgagcgacgaattcgagggctcct
A0A8C5YPB3_BIK-01          agacccacggcccccagcacccgggtgc----------------------
A0A8C5YNZ8_BCL2L11-01      -gcccggagatctggatcgcgcaggagctgcggcgaattggagatgagtt
A0A8C5YNZ8_BCL2L11-02      -gcccggagatctggatcgcgcaggagctgcggcgaattggagatgagtt
A0A8C6A5T3_BMF-01          -gagcagaggtacagatcgcccgaaaacttcagtgcattgcagaccagtt
                                                                             

A0A8C5YUG6_PMAIP1-01       aaatttccgtcagaaacttctga---------------------------
A0A8C6A7B1_PMAIP1-01       gaatttccataagaaacttctga---------------------------
A0A8C5Z4I8_BAD-01          ttaagggacttcctcgcccgaggagcgcgggcacagcgtcgcagatgcgg
A0A8C5YPB3_BIK-01          -ctcctgccc-------------------------gggcctgccgggagc
A0A8C5YNZ8_BCL2L11-01      taacctgtattacccacggagggtattttttaataattaccaacctgaag
A0A8C5YNZ8_BCL2L11-02      taacctgtattacccacggagggtattttttaataattaccaacctgaag
A0A8C6A5T3_BMF-01          ccaccggctt---------------------catatgcagcaacaccaac
                                                                             

A0A8C5YUG6_PMAIP1-01       ----------------------------------atttgatttccaaact
A0A8C6A7B1_PMAIP1-01       ----------------------------------atttgattttcagacc
A0A8C5Z4I8_BAD-01          caaagctccagctggacgcgcttcatccagtcctggtgggatcggaactt
A0A8C5YPB3_BIK-01          tgctgcccgtgctgctgc-tgctgggcctgttgctgagcagg---gccct
A0A8C5YNZ8_BCL2L11-01      accacccccaaatggtta-tcttgcgcctgttgcgttgcatcatccgcct
A0A8C5YNZ8_BCL2L11-02      accacccccaaatggtta-tcttgcgcctgttgcgttgcatcatccgcct
A0A8C6A5T3_BMF-01          agaaccgaaatcgtgtgt-ggtggcagattctcctcttcctgcacaacct
                                                                             

A0A8C5YUG6_PMAIP1-01       cttcagt--------------------------tta-gtaacctga
A0A8C6A7B1_PMAIP1-01       cttcagt--------------------------t----------ga
A0A8C5Z4I8_BAD-01          gggga-------------ggcgaggctccgc-cccc-tcccagtga
A0A8C5YPB3_BIK-01          gtacctg--------------------------cgg-ctccagtga
A0A8C5YNZ8_BCL2L11-01      ggtgtgg--------------------------agg-atgcactga
A0A8C5YNZ8_BCL2L11-02      ggtgtgg--------------------------agg-atgcactga
A0A8C6A5T3_BMF-01          ggccttaaatggagatgagaacagggaccgggcaggtcctaggtga
                                                                       **

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice