Dataset for CDS classical BH3-containing proteins of organism Mandrillus leucophaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5ZWH1_PMAIP1-      atgc------------------------------------ctgggaagaa
A0A2K5ZWH1_PMAIP1-      atgc------------------------------------ctgggaagaa
A0A2K5XSA1_BIK-01       atgt------------ctggagtaagacccatctccagagacaccttgat
A0A2K5Z7V3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K5Z7V3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K5Z4A9_BMF-01       atgg----------agcc-at-----ctcggtgtgtg-----gaggagct
A0A2K5Z4A9_BMF-02       atgg----------agcc-at-----ctcggtgtgtg-----gaggagct
A0A2K5XJR2_BAD-01       atgt----------tccagat-----cccagagtttgagcctagtgagca
A0A2K5XJR2_BAD-02       atgt----------tccagat-----cccagagtttgagcctagtgagca
                        ***                                            *  

A0A2K5ZWH1_PMAIP1-      ggcgcgcaagaacgcgcaacc-----------------------------
A0A2K5ZWH1_PMAIP1-      ggcgcgcaagaacgcgcaacc-----------------------------
A0A2K5XSA1_BIK-01       ggag---------accctcctgtatgagcag--------------ctcct
A0A2K5Z7V3_BCL2L11      ggtagacaa----ttgcagcc-tgcggagaggcctccccagctcagacct
A0A2K5Z7V3_BCL2L11      ggtagacaa----ttgcagcc-tgcggagaggcctccccagctcagacct
A0A2K5Z4A9_BMF-01       ggaggatgatgtgttccagccggaggacggg--------------gagcc
A0A2K5Z4A9_BMF-02       ggaggatgatgtgttccagccggaggacggg--------------gagcc
A0A2K5XJR2_BAD-01       ggaaga-------ctccagctctgcagagag--------------gggcc
A0A2K5XJR2_BAD-02       ggaaga-------ctccagctctgcagagag--------------gggcc
                        **              *  *                              

A0A2K5ZWH1_PMAIP1-      -gagccc-----------------------aacgcgggctcaggcaggac
A0A2K5ZWH1_PMAIP1-      -gagccc-----------------------aacgcgggctcaggcag---
A0A2K5XSA1_BIK-01       ggaacccctaaccatggaggttcttggtgtgactgaccctga--------
A0A2K5Z7V3_BCL2L11      ggggcccctacctccctaca----------gacagagccaca--------
A0A2K5Z7V3_BCL2L11      ggggcccctacctccctaca----------gacagagccacaaggtaatc
A0A2K5Z4A9_BMF-01       gggggcccaaccc----ggg----------agctcgctctct--------
A0A2K5Z4A9_BMF-02       gggggcccaaccc----ggg----------agctcgctctct--------
A0A2K5XJR2_BAD-01       tgggccccagcctcgcgggg----------gacaggccctca--------
A0A2K5XJR2_BAD-02       tgggccccagcctcgcgggg----------gacaggccctca--------
                         *   **                         *     *           

A0A2K5ZWH1_PMAIP1-      aggcagggacggcagggacggcgagggaccaggccggatttgggattggg
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
                                                                          

A0A2K5ZWH1_PMAIP1-      atgcaactgcatttcaccagaggcaaaaagctcgtctcctcctccccact
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       -----------------agaggacct-------ggaccctatggaggact
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5Z4A9_BMF-01       ---gccgatctgtttgcccagagcctacttgactgccccctcagccgact
A0A2K5Z4A9_BMF-02       ---gccgatctgtttgcccagagcctacttgactgccccctcagccgact
A0A2K5XJR2_BAD-01       ---gac--------tgcggcaagcat------------catcgccaggcc
A0A2K5XJR2_BAD-02       ---gac--------tgcggcaagcat------------catcgccaggcc
                                                                          

A0A2K5ZWH1_PMAIP1-      tgcccttccg-----------------------------cggggccacga
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       tcgatccttt----------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5Z4A9_BMF-01       tcagctcttc----------------------------------------
A0A2K5Z4A9_BMF-02       tcagctcttc----------------------------------------
A0A2K5XJR2_BAD-01       ccaggcctcc----------------------------------------
A0A2K5XJR2_BAD-02       ccaggcctcc----------------------------------------
                                                                          

A0A2K5ZWH1_PMAIP1-      ggaacaagtgcaagtagctcgaagtcgag------------------tgt
A0A2K5ZWH1_PMAIP1-      ---------------agctcgaagtcgag------------------tgt
A0A2K5XSA1_BIK-01       ggagtgtatggaggacagtgacatgttggccctgcggc---------tgg
A0A2K5Z7V3_BCL2L11      ----------------------agacagg---agcc--------------
A0A2K5Z7V3_BCL2L11      gtgggtatttctcttttgacacagacagg---agcc--------------
A0A2K5Z4A9_BMF-01       --------------cctctcacccactgc---tgtggccctggccttcga
A0A2K5Z4A9_BMF-02       --------------cctctcacccactgc---tgtggccctggccttcga
A0A2K5XJR2_BAD-01       -----tgtgggacgccagtcaccagcagg---agcagc---------caa
A0A2K5XJR2_BAD-02       -----tgtgggacgccagtcaccagcagg---agcagc---------caa
                                                                          

A0A2K5ZWH1_PMAIP1-      gctactcaactcaggagatttgg---------------------------
A0A2K5ZWH1_PMAIP1-      gctactcaactcaggagatttgg---------------------------
A0A2K5XSA1_BIK-01       cctgcatcggggacgaga--tgg---------------------------
A0A2K5Z7V3_BCL2L11      ----cagcacccatgagttgtga---------------------------
A0A2K5Z7V3_BCL2L11      ----cagcacccatgagttgtga---------------------------
A0A2K5Z4A9_BMF-01       cc--caccagccagga----aga---------------------------
A0A2K5Z4A9_BMF-02       cc--caccagccagga----aga---------------------------
A0A2K5XJR2_BAD-01       ccagcagcagccatca----tggaggcgctggggctgtggagacccggag
A0A2K5XJR2_BAD-02       ccagcagcagccatca----tgg---------------------------
                            *       *  *     *                            

A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5XJR2_BAD-01       tcgccacagctcctaccccgcggggacggaggaggacgaagggatggagg
A0A2K5XJR2_BAD-02       --------------------------------------------------
                                                                          

A0A2K5ZWH1_PMAIP1-      -------------------agacaaactgaacttccggc-----------
A0A2K5ZWH1_PMAIP1-      -------------------agacaaactgaacttccggc-----------
A0A2K5XSA1_BIK-01       ------------------------atgtgagcctcagggcccc-------
A0A2K5Z7V3_BCL2L11      -----------------caaatcaacacaaaccccaagtcctccttgcca
A0A2K5Z7V3_BCL2L11      -----------------caaatcaacacaaaccccaagtcctccttgcca
A0A2K5Z4A9_BMF-01       -----------------caaggccacccagaccctcggcccagcct----
A0A2K5Z4A9_BMF-02       -----------------caaggccacccagaccctcggcccagcct----
A0A2K5XJR2_BAD-01       aggagcccagcccctttcggggccgctcgcgctccgcgccccccaa----
A0A2K5XJR2_BAD-02       --------------------------------------------------
                                                                          

A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       -gcgcctggcccagctctc-------------------------------
A0A2K5Z7V3_BCL2L11      ggccttcaaccactatctcagtgc--------------------------
A0A2K5Z7V3_BCL2L11      ggccttcaaccactatctcagtgc--------------------------
A0A2K5Z4A9_BMF-01       --cccccagccaaggtgtcat-----------------------------
A0A2K5Z4A9_BMF-02       --cccccagccaaggtgtcat-----------------------------
A0A2K5XJR2_BAD-01       --cctctgggcagcacagcgttatggccgcgagctccggaggatgagtga
A0A2K5XJR2_BAD-02       --------------------------------------------------
                                                                          

A0A2K5ZWH1_PMAIP1-      --------------------agaaacttct--------------------
A0A2K5ZWH1_PMAIP1-      --------------------agaaacttct--------------------
A0A2K5XSA1_BIK-01       --------------------tgaggtggccatgc----------------
A0A2K5Z7V3_BCL2L11      --------------------aatggt-------agtcattctaga-----
A0A2K5Z7V3_BCL2L11      --------------------aatggcttccaggaggcaggctgaacctgc
A0A2K5Z4A9_BMF-01       ------------------------gctgccttgtggggtaactga-----
A0A2K5Z4A9_BMF-02       ------------------------gctgccttgtggggtaactga-----
A0A2K5XJR2_BAD-01       cgagtttgtggactcctttaagggacttcctcgc-------ccga-----
A0A2K5XJR2_BAD-02       --------------------agggacttcctcgc-------ccga-----
                                                                          

A0A2K5ZWH1_PMAIP1-      ------------gaatct----gatagccaaactcttctgctcagg----
A0A2K5ZWH1_PMAIP1-      ------------gaatct----gatagccaaactcttctgctcagg----
A0A2K5XSA1_BIK-01       ------------acagcctgggtctggct-ttcatctacgaccagacgga
A0A2K5Z7V3_BCL2L11      ------------ggatataggtgatagttcattgtttg------------
A0A2K5Z7V3_BCL2L11      agatatgcgcccggagatacg-gatcgcccaagagttgcggcgaatcgga
A0A2K5Z4A9_BMF-01       ------------ggaac-----cccagcgactcttttacggcaatgctgg
A0A2K5Z4A9_BMF-02       ------------ggaac-----cccagcgactcttttacg----------
A0A2K5XJR2_BAD-01       ------------agagcgcgggcacagcgacgcagatgcggcaaagct--
A0A2K5XJR2_BAD-02       ------------agagcgcgggcacagcgacgcagatgcggcaaagct--
                                      *           *         *             

A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       cgacatcagggatgttcttagaagtttcctggatggttt-----------
A0A2K5Z7V3_BCL2L11      -----gatttata-------tttact--------ggctt-----------
A0A2K5Z7V3_BCL2L11      gacgagtttaacg-------cttactatgcaaggagggt-----------
A0A2K5Z4A9_BMF-01       ctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgggg
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------ccagctggacgcgagtctt-----------
A0A2K5XJR2_BAD-02       --------------------ccagctggacgcgagtctt-----------
                                                                          

A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z4A9_BMF-01       agcagccccccgaagggcagtggcaacatcgagcagaggtacagattgcc
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
                                                                          

A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       ---------------------------------------------cacca
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z4A9_BMF-01       cgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagca
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5XJR2_BAD-01       -----------------------------------------------cca
A0A2K5XJR2_BAD-02       -----------------------------------------------cca
                                                                          

A0A2K5ZWH1_PMAIP1-      aacctgactgcatcaaaaacttgcataa------ggggactccaaaagag
A0A2K5ZWH1_PMAIP1-      aacctga-------------------------------------------
A0A2K5XSA1_BIK-01       cccttagggagaacataatgaggttctg---------gagatccccgaa-
A0A2K5Z7V3_BCL2L11      agatttgtatggccaccaccacagtcaagatacagaacaactcaaccaca
A0A2K5Z7V3_BCL2L11      atttttgaataattacca-agcagccga----------agaccacccaca
A0A2K5Z4A9_BMF-01       acaccagcagaaccgaaatcgcgtgtgg------tggcagatcctcctc-
A0A2K5Z4A9_BMF-02       -caccagcagaaccgaaatcgcgtgtgg------tggcagatcctcctc-
A0A2K5XJR2_BAD-01       gtcctggtgggatcggaa-cttgggcag------gggaagctccgcccc-
A0A2K5XJR2_BAD-02       gtcctggtgggatcggaa-cttgggcag------gggaagctccgcccc-
                                                                          

A0A2K5ZWH1_PMAIP1-      actttttctcaggaggtgcatacttcataaatttgaagaaagattgcatt
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       ------tcccaggtcctgggtgtcccgtgaacaggtgctgctgctgctgg
A0A2K5Z7V3_BCL2L11      a--ggatttctcatga----------------------------------
A0A2K5Z7V3_BCL2L11      aatggttatcttacgactgttgcgttacattg------------------
A0A2K5Z4A9_BMF-01       ------ttcctgcacaaccttgctttgaatggagaag-------------
A0A2K5Z4A9_BMF-02       ------ttcctgcacaaccttgctttgaatggagaag-------------
A0A2K5XJR2_BAD-01       ------ctcccagtga----------------------------------
A0A2K5XJR2_BAD-02       ------ctcccagtgaccttcgctccacgccccgaaactccacccgctct
                                                                          

A0A2K5ZWH1_PMAIP1-      gtaattgg------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       cactgctg--------------------------------------ctgg
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      ----------------------------------------------tccg
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-02       caccgtcctggtcggccatcttggatatgggcggaagtgcttccctcagg
                                                                          

A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2K5XSA1_BIK-01       cgctgctcagcgggggcctgcacctgctgct-------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      cctggtgtggagaatgcattga----------------------------
A0A2K5Z4A9_BMF-01       --------agaacaggaacggggcgggccct-------------------
A0A2K5Z4A9_BMF-02       --------agaacaggaacggggcgggccct-------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-02       cctcatgcaaaagaggatccgtgctgcctctttcggtgggagggctgacc
                                                                          

A0A2K5ZWH1_PMAIP1-      ------------------------
A0A2K5ZWH1_PMAIP1-      ------------------------
A0A2K5XSA1_BIK-01       -----------------caagtga
A0A2K5Z7V3_BCL2L11      ------------------------
A0A2K5Z7V3_BCL2L11      ------------------------
A0A2K5Z4A9_BMF-01       ------------------aggtga
A0A2K5Z4A9_BMF-02       ------------------ag----
A0A2K5XJR2_BAD-01       ------------------------
A0A2K5XJR2_BAD-02       cagattcccttccggtgcatgtga
                                                

© 1998-2020Legal notice