Dataset for CDS BAD of organism Mandrillus leucophaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5XJR2_BAD-01      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2K5XJR2_BAD-02      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
                       **************************************************

A0A2K5XJR2_BAD-01      tgcagagaggggcctgggccccagcctcgcgggggacaggccctcagact
A0A2K5XJR2_BAD-02      tgcagagaggggcctgggccccagcctcgcgggggacaggccctcagact
                       **************************************************

A0A2K5XJR2_BAD-01      gcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2K5XJR2_BAD-02      gcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
                       **************************************************

A0A2K5XJR2_BAD-01      cagcaggagcagccaaccagcagcagccatcatggaggcgctggggctgt
A0A2K5XJR2_BAD-02      cagcaggagcagccaaccagcagcagccatcatgg---------------
                       ***********************************               

A0A2K5XJR2_BAD-01      ggagacccggagtcgccacagctcctaccccgcggggacggaggaggacg
A0A2K5XJR2_BAD-02      --------------------------------------------------
                                                                         

A0A2K5XJR2_BAD-01      aagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcg
A0A2K5XJR2_BAD-02      --------------------------------------------------
                                                                         

A0A2K5XJR2_BAD-01      ccccccaacctctgggcagcacagcgttatggccgcgagctccggaggat
A0A2K5XJR2_BAD-02      --------------------------------------------------
                                                                         

A0A2K5XJR2_BAD-01      gagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
A0A2K5XJR2_BAD-02      --------------------------agggacttcctcgcccgaagagcg
                                                 ************************

A0A2K5XJR2_BAD-01      cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttc
A0A2K5XJR2_BAD-02      cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttc
                       **************************************************

A0A2K5XJR2_BAD-01      cagtcctggtgggatcggaacttgggcaggggaagctccgccccctccca
A0A2K5XJR2_BAD-02      cagtcctggtgggatcggaacttgggcaggggaagctccgccccctccca
                       **************************************************

A0A2K5XJR2_BAD-01      gtga----------------------------------------------
A0A2K5XJR2_BAD-02      gtgaccttcgctccacgccccgaaactccacccgctctcaccgtcctggt
                       ****                                              

A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-02      cggccatcttggatatgggcggaagtgcttccctcaggcctcatgcaaaa
                                                                         

A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-02      gaggatccgtgctgcctctttcggtgggagggctgacccagattcccttc
                                                                         

A0A2K5XJR2_BAD-01      ------------
A0A2K5XJR2_BAD-02      cggtgcatgtga
                                   

© 1998-2020Legal notice