Dataset for CDS BCL2L11 of organism Malurus cyaneus samueli

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5TVU9_BCL2L11      --------------------------------------------------
A0A8C5UI47_BCL2L11      atggggcggggggcggggggtcgggccggccccggcgcgctcggccgctc
                                                                          

A0A8C5TVU9_BCL2L11      -----------------acatacaaatc----------------------
A0A8C5UI47_BCL2L11      accgcgctccgctccccgcaggcagcccgatggccaagcagcccccgagg
                                          **  **   *                      

A0A8C5TVU9_BCL2L11      -------------caactgtgag---------------------------
A0A8C5UI47_BCL2L11      tgaaggcgcgacgcgacggcgagggcgggcggctgccggcggcggagggc
                                     * ** * ***                           

A0A8C5TVU9_BCL2L11      --------------------------------------------------
A0A8C5UI47_BCL2L11      cgggcccgggcgcgcagctgcgcccggcgcccccgccgcctgcccgggcc
                                                                          

A0A8C5TVU9_BCL2L11      --------------------------------------------------
A0A8C5UI47_BCL2L11      gggccggcccggtgtcgccgccgccgcggcgcggggcccgccgaccggcc
                                                                          

A0A8C5TVU9_BCL2L11      ------------------------------ttttatggag----------
A0A8C5UI47_BCL2L11      ccttcgccacccgctcgccgctcttcatcttcgtgcggaggtcgccgctg
                                                      *  *  ****          

A0A8C5TVU9_BCL2L11      ------------tacagtctgtacaatttgtt------------------
A0A8C5UI47_BCL2L11      ctgccgcgctcctccagtgggtacttctcgttcgaagccgagcgcagccc
                                    * ****  ****   * ***                  

A0A8C5TVU9_BCL2L11      cttgcccttggttc----caatgct--------------cccactttgtc
A0A8C5UI47_BCL2L11      cgcgcccctgggctgcgacaaggccacgcagacccccagcccgccctgcc
                        *  **** ***       *** **               *** *  ** *

A0A8C5TVU9_BCL2L11      ------------------------ccatgcagcttcccggtggcagtccc
A0A8C5UI47_BCL2L11      aggcgctcagccactgcctcagcgccatg--gcttcccggtggcagtccc
                                                *****  *******************

A0A8C5TVU9_BCL2L11      actctccagccgaagaggtgcagccggaaatctggattgcccaggagctg
A0A8C5UI47_BCL2L11      actctccagccgaagaggtgcagccggaaatctggattgcccaggagct-
                        ************************************************* 

A0A8C5TVU9_BCL2L11      agacgcatcggggacgagttcaatgcctcctattgtccacgcagggtaac
A0A8C5UI47_BCL2L11      ---------------gagctcactgctttgtttggt--------------
                                       *** *** *** *  * * **              

A0A8C5TVU9_BCL2L11      tttcctctct----------------tcactctccatttctctcaa----
A0A8C5UI47_BCL2L11      ttttctctcttttttgttttgttttgtttttctccctctttttcagggtt
                        *** ******                *   ***** * * * ***     

A0A8C5TVU9_BCL2L11      ----------------agggaa----------------------------
A0A8C5UI47_BCL2L11      tcttggatttccaggtggggaacccccaggtggtgatcctgcgcctgctg
                                         *****                            

A0A8C5TVU9_BCL2L11      ------------------------aggc-----tga
A0A8C5UI47_BCL2L11      cgttacatcatccgcctcatctggaggctccagtga
                                                ****     ***

© 1998-2022Legal notice