Dataset for CDS classical BH3-containing proteins of organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

24 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6BV43_PMAIP1-      atg-----------------------------------------------
A0A2K6BV43_PMAIP1-      atg-----------------------------------------------
A0A2K6E212_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E212_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E212_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E212_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E212_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E212_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E212_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E212_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E212_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E212_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6DBJ4_BIK-01       atg-----------------------tctggagtaagacccat-------
A0A2K6B5F6_BMF-01       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A2K6B5F6_BMF-02       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A2K6B5F6_BMF-04       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A2K6B5F6_BMF-03       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A2K6E7I4_BAD-02       atgttccag---------------atcccagagtttgagcctagtgagca
A0A2K6E7I4_BAD-03       atgttccag---------------atcccagagtttgagcctagtgagca
A0A2K6E7I4_BAD-01       atgttccag---------------atcccagagtttgagcctagtgagca
A0A2K6AYL7_HRK-01       atg--------------------------------t--------------
A0A2K6ASP2_BBC3-02      ataaaattt---------------ggcgtggggtct--------------
A0A2K6ASP2_BBC3-01      ataaaattt---------------ggcgtggggtct--------------
A0A2K6ASP2_BBC3-03      ataaaattt---------------ggcgtggggtct--------------
                        **                                                

A0A2K6BV43_PMAIP1-      --------------------------------------cctgggaagaag
A0A2K6BV43_PMAIP1-      --------------------------------------cctgggaagaag
A0A2K6E212_BCL2L11      ggtagacaatt--------------------------------------g
A0A2K6E212_BCL2L11      ggtagacaatt--------------------------------------g
A0A2K6E212_BCL2L11      ggtagacaatt--------------------------------------g
A0A2K6E212_BCL2L11      ggtagacaatt--------------------------------------g
A0A2K6E212_BCL2L11      ggtagacaatt--------------------------------------g
A0A2K6E212_BCL2L11      ggtagacaatt--------------------------------------g
A0A2K6E212_BCL2L11      ggtagacaatt--------------------------------------g
A0A2K6E212_BCL2L11      ggtagacaatt--------------------------------------g
A0A2K6E212_BCL2L11      ggtagacaatt--------------------------------------g
A0A2K6E212_BCL2L11      ggtagacaatt--------------------------------------g
A0A2K6DBJ4_BIK-01       -------------ctccagagacaccttgatggagaccctcctgtatgag
A0A2K6B5F6_BMF-01       ggaggatgatgtgttccag-------------------ccggaggacggg
A0A2K6B5F6_BMF-02       ggaggatgatgtgttccag-------------------ccggaggacggg
A0A2K6B5F6_BMF-04       ggaggatgatgtgttccag-------------------ccggaggacggg
A0A2K6B5F6_BMF-03       ggaggatgatgtgttccag-------------------ccggaggacggg
A0A2K6E7I4_BAD-02       ggaaga-------ctccag-------------------ctctgcagagag
A0A2K6E7I4_BAD-03       ggaaga-------ctccag-------------------ctctgcagagag
A0A2K6E7I4_BAD-01       ggaaga-------ctccag-------------------ctctgcagagag
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      gcgcgcaagaacgcgcaaccga----------------------------
A0A2K6BV43_PMAIP1-      gcgcgcaagaacgcgcaaccga----------------------------
A0A2K6E212_BCL2L11      cagcctgcggagaggcctccccag--------------ctcagacctggg
A0A2K6E212_BCL2L11      cagcctgcggagaggcctccccag--------------ctcagacctggg
A0A2K6E212_BCL2L11      cagcctgcggagaggcctccccag--------------ctcagacctggg
A0A2K6E212_BCL2L11      cagcctgcggagaggcctccccag--------------ctcagacctggg
A0A2K6E212_BCL2L11      cagcctgcggagaggcctccccag--------------ctcagacctggg
A0A2K6E212_BCL2L11      cagcctgcggagaggcctccccag--------------ctcagacctggg
A0A2K6E212_BCL2L11      cagcctgcggagaggcctccccag--------------ctcagacctggg
A0A2K6E212_BCL2L11      cagcctgcggagaggcctccccag--------------ctcagacctggg
A0A2K6E212_BCL2L11      cagcctgcggagaggcctccccag--------------ctcagacctggg
A0A2K6E212_BCL2L11      cagcctgcggagaggcctccccag--------------ctcagacctggg
A0A2K6DBJ4_BIK-01       cagctcctggaacccctaaccatggaggttcttggtgtcactgaccctga
A0A2K6B5F6_BMF-01       gagccggggg----cccaacccgggag-----------ctcgctctctgc
A0A2K6B5F6_BMF-02       gagccggggg----cccaacccgggag-----------ctcgctctctgc
A0A2K6B5F6_BMF-04       gagccggggg----cccaacccgggag-----------ctcgctctctgc
A0A2K6B5F6_BMF-03       gagccggggg----cccaacccgggag-----------ctcgctctctgc
A0A2K6E7I4_BAD-02       gggcctgggc----cccagccccgcgggggacaggc-cctcagactccgg
A0A2K6E7I4_BAD-03       gggcctgggc----cccagccccgcgggggacaggc-cctcagactccgg
A0A2K6E7I4_BAD-01       gggcctgggc----cccagccccgcgggggacaggc-cctcagactccgg
A0A2K6AYL7_HRK-01       --gcccgtgc---cccctgcaccgc-------------------------
A0A2K6ASP2_BBC3-02      --gcccgggcatgtccatgccaggt-------------------------
A0A2K6ASP2_BBC3-01      --gcccgggcatgtccatgccaggt-------------------------
A0A2K6ASP2_BBC3-03      --gcccgggcatgtccatgccaggt-------------------------
                          **    *      *   *                              

A0A2K6BV43_PMAIP1-      ----------------gccca-----------------------------
A0A2K6BV43_PMAIP1-      ----------------gccca-----------------------------
A0A2K6E212_BCL2L11      ----------------gcccc------tacctcc-------------cta
A0A2K6E212_BCL2L11      ----------------gcccc------tacctcc-------------cta
A0A2K6E212_BCL2L11      ----------------gcccc------tacctcc-------------cta
A0A2K6E212_BCL2L11      ----------------gcccc------tacctcc-------------cta
A0A2K6E212_BCL2L11      ----------------gcccc------tacctcc-------------cta
A0A2K6E212_BCL2L11      ----------------gcccc------tacctcc-------------cta
A0A2K6E212_BCL2L11      ----------------gcccc------tacctcc-------------cta
A0A2K6E212_BCL2L11      ----------------gcccc------tacctcc-------------cta
A0A2K6E212_BCL2L11      ----------------gcccc------tacctcc-------------cta
A0A2K6E212_BCL2L11      ----------------gcccc------tacctcc-------------cta
A0A2K6DBJ4_BIK-01       agaggacctg------gaccctatggaggacttcgatcctttggagtgta
A0A2K6B5F6_BMF-01       cgatctgttt------gccca-----gagcctacttgactgccccctcag
A0A2K6B5F6_BMF-02       cgatctgttt------gccca-----gagcctacttgactgccccctcag
A0A2K6B5F6_BMF-04       cgatctgttt------gccca-----gagcctacttgactgccccctcag
A0A2K6B5F6_BMF-03       cgatctgttt------gccca-----gagcctacttgactgccccctcag
A0A2K6E7I4_BAD-02       caagcatcatcgccaggcccc-----aggcctcc------------tgtg
A0A2K6E7I4_BAD-03       caagcatcatcgccaggcccc-----aggcctcc------------tgtg
A0A2K6E7I4_BAD-01       caagcatcatcgccaggcccc-----aggcctcc------------tgtg
A0A2K6AYL7_HRK-01       ----------------ggccg-----cggccccccggccgtgtgcgcctg
A0A2K6ASP2_BBC3-02      ----------------gccca-----gggcttct------------tctg
A0A2K6ASP2_BBC3-01      ----------------gccca-----gggcttct------------tctg
A0A2K6ASP2_BBC3-03      ----------------gccca-----gggcttct------------tctg
                                        * **                              

A0A2K6BV43_PMAIP1-      ---acgcggg-----------ctcaggcaggaccggc-------------
A0A2K6BV43_PMAIP1-      ---acgcggg-----------ctcaggcag--------------------
A0A2K6E212_BCL2L11      cagaca-gag----------ccaca-------------------------
A0A2K6E212_BCL2L11      cagaca-ga-----------------------------------------
A0A2K6E212_BCL2L11      cagaca-gag----------ccacaaggtaatcccga-------------
A0A2K6E212_BCL2L11      cagaca-gag----------ccacaaggtaatcccga-------------
A0A2K6E212_BCL2L11      cagaca-gag----------ccacaaggtaatcccga-------------
A0A2K6E212_BCL2L11      cagaca-gag----------ccaca-------------------------
A0A2K6E212_BCL2L11      cagaca-gag----------ccacaaggtaatcccga-------------
A0A2K6E212_BCL2L11      cagaca-gag----------ccacaaggtaatcccga-------------
A0A2K6E212_BCL2L11      cagaca-gag----------ccacaaggtaatcccga-------------
A0A2K6E212_BCL2L11      cagaca-gag----------ccacaaggtaatcccga-------------
A0A2K6DBJ4_BIK-01       tagaggacag----------tgacatgttggccctgc-------------
A0A2K6B5F6_BMF-01       ccgacttcagctcttccctctcacccactgctgtggc-------------
A0A2K6B5F6_BMF-02       ccgacttcagctcttccctctcacccactgctgtggc-------------
A0A2K6B5F6_BMF-04       ccgacttcagctcttccctctcacccactgctgtggc-------------
A0A2K6B5F6_BMF-03       ccgacttcagctcttccctctcacccactgctgtggc-------------
A0A2K6E7I4_BAD-02       -ggacgccag----------tcaccagcaggagcagc-------------
A0A2K6E7I4_BAD-03       -ggacgccag----------tcaccagcaggagcagc-------------
A0A2K6E7I4_BAD-01       -ggacgccag----------tcaccagcaggagcagc-------------
A0A2K6AYL7_HRK-01       -cagcgcggg----------tcgcttg---gggctgc-------------
A0A2K6ASP2_BBC3-02      -cgacgtggg----------tcccctgccagatttgt-------------
A0A2K6ASP2_BBC3-01      -cgacgtggg----------tcccctgccagatttgtggccccagggagc
A0A2K6ASP2_BBC3-03      -cgacgtggg----------tcccctgccagatttgt-------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      gccatggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      cctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccct
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      cggcagtgtcctgcggcctctgcgagcccggcctggctgccgcccccgcc
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      gcccccgccctgctgcccgctgcctacctctgcgcccccaccgccccacc
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      cgccgtcaccgccaccctggggggcccccgctggcctgggggtccccgca
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      -----------------------------------aggcaatcacggagg
A0A2K6E212_BCL2L11      -----------------------------------aggcaatcacggagg
A0A2K6E212_BCL2L11      -----------------------------------aggcaatcacggagg
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      -----------------------------------aggcaatcacggagg
A0A2K6E212_BCL2L11      -----------------------------------aggcaatcacggagg
A0A2K6E212_BCL2L11      -----------------------------------aggcaatcacggagg
A0A2K6E212_BCL2L11      -----------------------------------aggcaatcacggagg
A0A2K6DBJ4_BIK-01       -------------------------------------------------g
A0A2K6B5F6_BMF-01       ------------------------------------------cctggcct
A0A2K6B5F6_BMF-02       ------------------------------------------cctggcct
A0A2K6B5F6_BMF-04       ------------------------------------------cctggcct
A0A2K6B5F6_BMF-03       ------------------------------------------cctggcct
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       ------------------------------------------gctcgtcc
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      gccggccccgaggcccacgcccggacggtcctcagccctcgctcttgctg
A0A2K6ASP2_BBC3-03      --------------------------ggtcctcagccctcgctcttgctg
                                                                          

A0A2K6BV43_PMAIP1-      ----agggacggcagggacggcgagggaccaggccggattt---------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      tgaaggggacagctgcccccacggcagccc--------------------
A0A2K6E212_BCL2L11      tgaaggggacagctgcccccacggcagccc--------------------
A0A2K6E212_BCL2L11      tgaaggggacagctgcccccacggcagccc--------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      tgaaggggacagctgcccccacggcagccc--------------------
A0A2K6E212_BCL2L11      tgaaggggacagctgcccccacggcagccc--------------------
A0A2K6E212_BCL2L11      tgaaggggacagctgcccccacggcagccc--------------------
A0A2K6E212_BCL2L11      tgaaggggacagctgcccccacggcagccc--------------------
A0A2K6DBJ4_BIK-01       gctggcctgcatcggggac-------------------------------
A0A2K6B5F6_BMF-01       tcgacccaccagc-------------------------------------
A0A2K6B5F6_BMF-02       tcgacccaccagc-------------------------------------
A0A2K6B5F6_BMF-04       tcgacccaccagc-------------------------------------
A0A2K6B5F6_BMF-03       tcgacccaccagc-------------------------------------
A0A2K6E7I4_BAD-02       --caaccagcagcagccatcatggagggacttcct---------------
A0A2K6E7I4_BAD-03       --caaccagcagcagccatcatggagggagagcttggtattctccttctt
A0A2K6E7I4_BAD-01       --caaccagcagcagccatcatgg--------------------------
A0A2K6AYL7_HRK-01       gccgcgcagc--------tcaccgccgcccggc-----------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      gcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggc
A0A2K6ASP2_BBC3-03      gcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggc
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-03       gggaatctgaggactctgaaaatcccagtgcaaggatgctcgcggaagca
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      gggcgg--------------------------------------------
A0A2K6ASP2_BBC3-03      gggcgg--------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      ---------------------------------------------gggat
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       ---------------------------------------------gagat
A0A2K6B5F6_BMF-01       ---------------------------------------------cagga
A0A2K6B5F6_BMF-02       ---------------------------------------------cagga
A0A2K6B5F6_BMF-04       ---------------------------------------------cagga
A0A2K6B5F6_BMF-03       ---------------------------------------------cagga
A0A2K6E7I4_BAD-02       ------------------------------------------cgcccgaa
A0A2K6E7I4_BAD-03       tcagcacggatgtctgccccagccactgactcagaagcccaacacgcaga
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      --------------tcccacccaggcggccccgggagtccgcggggagga
A0A2K6ASP2_BBC3-03      --------------tcccacccaggcggccccgggagtccgcggggagga
                                                                          

A0A2K6BV43_PMAIP1-      tgggatgcagctgcattacaccagaggcaaaaagctcgtctcctcctccc
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------ccctggcccttt
A0A2K6E212_BCL2L11      -----------tcagggcccgctggccccaccggccagccctggcccttt
A0A2K6E212_BCL2L11      -----------tcagggcccgctggccccaccggccagccctggcccttt
A0A2K6E212_BCL2L11      -----------tcagggcccgctggccccaccggccagccctggcccttt
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      -----------tcagggcccgctggccccaccggccagccctggcccttt
A0A2K6E212_BCL2L11      -----------tcagggcccgctggccccaccggccagccctggcccttt
A0A2K6E212_BCL2L11      -----------tcagggcccgctggccccaccggccagccctggcccttt
A0A2K6E212_BCL2L11      -----------tcagggcccgctggccccaccggccagccctggcccttt
A0A2K6DBJ4_BIK-01       ggatgtgagcctcagggccccgcgcctggcccagctctctgaggtggcca
A0A2K6B5F6_BMF-01       agacaaggccacccagaccctcggc---------------------ccag
A0A2K6B5F6_BMF-02       agacaaggccacccagaccctcggc---------------------ccag
A0A2K6B5F6_BMF-04       agacaaggccacccagaccctcggc---------------------ccag
A0A2K6B5F6_BMF-03       agacaaggccacccagaccctcggc---------------------ccag
A0A2K6E7I4_BAD-02       gagcgcgggcacagcgacgcagatgcggcaaagctccagctggacgcgag
A0A2K6E7I4_BAD-03       gaatgtaaagctgaaggcgctggggctgtggagacccg--cagtcgccac
A0A2K6E7I4_BAD-01       --------------aggcgctggggctgtggagacccg--cagtcgccac
A0A2K6AYL7_HRK-01       -----------tcaaggcgcttggcgacgagctgc---------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      ggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacg
A0A2K6ASP2_BBC3-03      ggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacg
                                                                          

A0A2K6BV43_PMAIP1-      cacttgtccttccgcggggccacgaggaacaagtgcaagtagctcgaagt
A0A2K6BV43_PMAIP1-      ----------------------------------------agctcgaagt
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      tgctaccagatcccc-----------------------------------
A0A2K6E212_BCL2L11      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
A0A2K6E212_BCL2L11      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
A0A2K6E212_BCL2L11      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
A0A2K6E212_BCL2L11      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
A0A2K6E212_BCL2L11      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
A0A2K6E212_BCL2L11      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
A0A2K6DBJ4_BIK-01       tgcacagcc-----tgggtctggctttcatctacgacca-----------
A0A2K6B5F6_BMF-01       cctcccccagccaaggtgtcatgctgccttgtggggtaa-----------
A0A2K6B5F6_BMF-02       cctcccccagccaaggtgtcatgctgccttgtggggtaa-----------
A0A2K6B5F6_BMF-04       cctcccccagccaaggtgtcatgctgccttgtggggtaa-----------
A0A2K6B5F6_BMF-03       cctcccccagccaaggtgtcatgctgccttgtggggtaa-----------
A0A2K6E7I4_BAD-02       tcttccagtcctggtgggatcg--------gaacttggg-----------
A0A2K6E7I4_BAD-03       agctcctaccccgcggggacggaggaggacgaagggatg-----------
A0A2K6E7I4_BAD-01       agctcctaccccgcggggacggaggaggacgaagggatg-----------
A0A2K6AYL7_HRK-01       ----------------------------accagcgcacc-----------
A0A2K6ASP2_BBC3-02      -------------------------gagacaagaggagc-----------
A0A2K6ASP2_BBC3-01      acctcaacgcgcaatacgagcggcggagacaagaggagc-----------
A0A2K6ASP2_BBC3-03      acctcaacgcgcaatacgagcggcggagacaagaggagc-----------
                                                                          

A0A2K6BV43_PMAIP1-      cg--------------------------------agtgtgctactcaact
A0A2K6BV43_PMAIP1-      cg--------------------------------agtgtgctactcaact
A0A2K6E212_BCL2L11      ----------------------------------agacaggagcccagca
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
A0A2K6E212_BCL2L11      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
A0A2K6E212_BCL2L11      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
A0A2K6E212_BCL2L11      ----------------------------------agacaggagcccagca
A0A2K6E212_BCL2L11      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
A0A2K6E212_BCL2L11      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
A0A2K6E212_BCL2L11      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
A0A2K6E212_BCL2L11      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
A0A2K6DBJ4_BIK-01       ----------------------------------gatggacgacatcagg
A0A2K6B5F6_BMF-01       ----------------------------------ctgaggaaccccagcg
A0A2K6B5F6_BMF-02       ----------------------------------ctgaggaaccccagcg
A0A2K6B5F6_BMF-04       ----------------------------------ctgaggaaccccagcg
A0A2K6B5F6_BMF-03       ----------------------------------ctgaggaaccccagcg
A0A2K6E7I4_BAD-02       ----------------------------------caggggaagctccgca
A0A2K6E7I4_BAD-03       ----------------------------------gaggaggagcccagc-
A0A2K6E7I4_BAD-01       ----------------------------------gaggaggagcccagc-
A0A2K6AYL7_HRK-01       ----------------------------------atgtggcggcgccgcg
A0A2K6ASP2_BBC3-02      ----------------------------------a-gcagcgacaccgcc
A0A2K6ASP2_BBC3-01      ----------------------------------a-gcagcgacaccgcc
A0A2K6ASP2_BBC3-03      ----------------------------------a-gcagcgacaccgcc
                                                                          

A0A2K6BV43_PMAIP1-      caggagatttggagaca----------aactaaac---------------
A0A2K6BV43_PMAIP1-      caggagatttggagaca----------aactaaac---------------
A0A2K6E212_BCL2L11      cccatgagttgtgacaa----------atcaacacaaaccccaagtcctc
A0A2K6E212_BCL2L11      --------ttgtgacaa----------atcaacacaaaccccaagtcctc
A0A2K6E212_BCL2L11      cccatgagttgtgacaa----------atcaacacaaaccccaagtcctc
A0A2K6E212_BCL2L11      cccatgagttgtgacaa----------atcaacacaaaccccaagtcctc
A0A2K6E212_BCL2L11      cccatgagttgtgacaa----------atcaacacaaaccccaagtcctc
A0A2K6E212_BCL2L11      cccatgagttgtgacaa----------atcaacacaaaccccaagtcctc
A0A2K6E212_BCL2L11      cccatgagttgtgacaa----------atcaacacaaaccccaagtcctc
A0A2K6E212_BCL2L11      cccatgagttgtgacaa----------atcaacacaaaccccaagtcctc
A0A2K6E212_BCL2L11      cccatgagttgtgacaa----------atcaacacaaaccccaagtcctc
A0A2K6E212_BCL2L11      cccatgagttgtgacaa----------atcaacacaaaccccaagtcctc
A0A2K6DBJ4_BIK-01       gatgttcttagaagtttcatggatggtttcaccac--------------c
A0A2K6B5F6_BMF-01       actcttttacggcaatgctggct----accggctt--------------c
A0A2K6B5F6_BMF-02       actcttttacggcaatgctggct----accggctt--------------c
A0A2K6B5F6_BMF-04       actcttttacggcaatgctggct----accggctt--------------c
A0A2K6B5F6_BMF-03       actcttttacg---------------------------------------
A0A2K6E7I4_BAD-02       ccc---tcccagtgacctt--cg----ctccacgc--------------c
A0A2K6E7I4_BAD-03       ccc---tttcggggccgctcgcg----ctccgcgc--------------c
A0A2K6E7I4_BAD-01       ccc---tttcggggccgctcgcg----ctccgcgc--------------c
A0A2K6AYL7_HRK-01       cgcggagccggagggcgccggcg----cccggcgc--------------g
A0A2K6ASP2_BBC3-02      cctcgccctggagg--------g----tcctgtac--------------a
A0A2K6ASP2_BBC3-01      cctcgccctggagg--------g----tcctgtac--------------a
A0A2K6ASP2_BBC3-03      cctcgccctggagg--------g----tcctgtac--------------a
                                                                          

A0A2K6BV43_PMAIP1-      -----------ttccggcagaaacttctgaatctgatagccaaa------
A0A2K6BV43_PMAIP1-      -----------ttccggcagaaacttctgaatctgatagccaaa------
A0A2K6E212_BCL2L11      cttgccaggccttcaaccactatctcagtgcaatggtagtca--------
A0A2K6E212_BCL2L11      cttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcag
A0A2K6E212_BCL2L11      cttgccaggccttcaaccactatctcagtgcaat----------------
A0A2K6E212_BCL2L11      cttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcag
A0A2K6E212_BCL2L11      cttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcag
A0A2K6E212_BCL2L11      cttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcag
A0A2K6E212_BCL2L11      cttgccaggccttcaaccactatctcagtgcaatggtt------------
A0A2K6E212_BCL2L11      cttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcag
A0A2K6E212_BCL2L11      cttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcag
A0A2K6E212_BCL2L11      cttgccaggccttcaaccactatctcagtgcaatggctaactgg------
A0A2K6DBJ4_BIK-01       cttagggagaacataatgaggttctggagatccccgaatcccaggtcc--
A0A2K6B5F6_BMF-01       ctctccctgccagtttcccggcagtcttgcccatcggggagcagcccccc
A0A2K6B5F6_BMF-02       ctctccctgccagtttcccggcagtcttgcccatcggggagcagcccccc
A0A2K6B5F6_BMF-04       ctctccctgccagtttcccggcagtcttgcccatcggggagcagcccccc
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       cggaaactccacccgct------ctcactgtcctcgtcggccatcttgga
A0A2K6E7I4_BAD-03       c----------cccaac------ctc------------------------
A0A2K6E7I4_BAD-01       c----------cccaac------ctc------------------------
A0A2K6AYL7_HRK-01       ct---------ccccac------ctactggccctggctg-----------
A0A2K6ASP2_BBC3-02      at---------ctcatcatgggactcctgcccttaccca-----------
A0A2K6ASP2_BBC3-01      at---------ctcatcatgggactcctgcccttaccca-----------
A0A2K6ASP2_BBC3-03      at---------ctcatcatgggactcctgcccttaccca-----------
                                                                          

A0A2K6BV43_PMAIP1-      -------------------------------------ctcttctgctcag
A0A2K6BV43_PMAIP1-      -------------------------------------ctcttctgctcag
A0A2K6E212_BCL2L11      ------------------tcctagaggatatag-----------gtgata
A0A2K6E212_BCL2L11      gctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcg
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      gctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcg
A0A2K6E212_BCL2L11      gctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcg
A0A2K6E212_BCL2L11      gctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcg
A0A2K6E212_BCL2L11      -----------------------agagaaatag-----------------
A0A2K6E212_BCL2L11      gctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcg
A0A2K6E212_BCL2L11      gctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcg
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --tgggt------------------------------gtcccgtgaacag
A0A2K6B5F6_BMF-01       gaagggcagtggcaacatcgagcagaggtacagattgcccgaaagcttca
A0A2K6B5F6_BMF-02       gaagggcagtggcaacatcgagcagaggtacagattgcccgaaagcttca
A0A2K6B5F6_BMF-04       gaagggcagtggcaacatcgagcagaggtacagattgcccgaaagcttca
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       tatgggc-------------ggaagtgcttccctcaggccttatgcaaaa
A0A2K6E7I4_BAD-03       --tgggc-------------agcacagcgt---tatggccgcgagctccg
A0A2K6E7I4_BAD-01       --tgggc-------------agcacagcgt---tatggccgcgagctccg
A0A2K6AYL7_HRK-01       --tgcgc-------------ggccgcgc--------------------ag
A0A2K6ASP2_BBC3-02      --ggggc-------------cacagagcccccgaaatggagcccaattag
A0A2K6ASP2_BBC3-01      --ggggc-------------cacagagcccccgaaatggagcccaattag
A0A2K6ASP2_BBC3-03      --ggggc-------------cacagagcccccgaaatggagcccaattag
                                                                          

A0A2K6BV43_PMAIP1-      gaacctg-------------------------------------------
A0A2K6BV43_PMAIP1-      gaacctg-------------------------------------------
A0A2K6E212_BCL2L11      gttcattgtggtttggatttatatttactggcttagatttgtatggccac
A0A2K6E212_BCL2L11      gcgaatcggagacgagtttaacgcttactatgcaaggagggtattttt--
A0A2K6E212_BCL2L11      --------------------------------------gggtattttt--
A0A2K6E212_BCL2L11      gcgaatcggagacgagtttaacgcttactatgcaaggagggtattttt--
A0A2K6E212_BCL2L11      gcgaatcggagacgagtttaacgcttactatgcaaggagggtattttt--
A0A2K6E212_BCL2L11      gcgaatcggagacgagtttaacgcttactatgcaaggagggtattttt--
A0A2K6E212_BCL2L11      ----------------------------------aggaagttgtc-----
A0A2K6E212_BCL2L11      gcgaatcggagacgagtttaacgcttactatgcaaggaggttagag----
A0A2K6E212_BCL2L11      gcgaatcggagacgagtttaacgcttactatgcaaggaggatgtcgcttc
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       gtgctgctg-----------------------------------------
A0A2K6B5F6_BMF-01       gtgcattgcagaccagttccaccggctccatgtgcagc------------
A0A2K6B5F6_BMF-02       gtgcattgcagaccagttccaccggctccatgtgcagc------------
A0A2K6B5F6_BMF-04       gtgcattgcagaccagttccaccggctccatgtgcagc------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       gaggatccgtgctgcctctttcg---------------------------
A0A2K6E7I4_BAD-03       gaggatga------------------------------------------
A0A2K6E7I4_BAD-01       gaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccga
A0A2K6AYL7_HRK-01       gtggcggcg-----------------------------------------
A0A2K6ASP2_BBC3-02      gtgcctgca-----------------------------------------
A0A2K6ASP2_BBC3-01      gtgcctgca-----------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      -----actgcatcaaaaacttgcataaggggactccaaaagagacttttt
A0A2K6BV43_PMAIP1-      -----a--------------------------------------------
A0A2K6E212_BCL2L11      -----caccacagtca------agatacagaacaactcaaccacaaggat
A0A2K6E212_BCL2L11      ----------gaataattaccaagcagccgaagaccacccacaaatggtt
A0A2K6E212_BCL2L11      ----------gaataa----------------------------------
A0A2K6E212_BCL2L11      ----------gaataattaccaagcagccgaagaccacccacaaatggtt
A0A2K6E212_BCL2L11      ----------gaataattaccaagcagccgaagaccacccacaaatggtt
A0A2K6E212_BCL2L11      ----------gaataattaccaagcagccgaagaccacccacaaatggtt
A0A2K6E212_BCL2L11      ----------gtgtag----------------------------------
A0A2K6E212_BCL2L11      ----------aaatag----------------------------------
A0A2K6E212_BCL2L11      -----cacctgattaa----------------------------------
A0A2K6E212_BCL2L11      ----------gactag----------------------------------
A0A2K6DBJ4_BIK-01       ----------------------------gtgctgctgctgctgctggcac
A0A2K6B5F6_BMF-01       -----aacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctct
A0A2K6B5F6_BMF-02       -----aacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctct
A0A2K6B5F6_BMF-04       -----aacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctct
A0A2K6B5F6_BMF-03       -------caccagcagaaccgaaatcgcgtgtggtggcagatcctcctct
A0A2K6E7I4_BAD-02       -----gtgggagggctgacccagattc-----------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-01       agagcgcgggcacagcgacgcagatgcggcaaagctccagctggacgcga
A0A2K6AYL7_HRK-01       -----ctggcggcctgg---------------------------------
A0A2K6ASP2_BBC3-02      -----cccgcccggtggacgtcagggactcggggggcaggcccctcccac
A0A2K6ASP2_BBC3-01      -----cccgcccggtggacgtcagggactcggggggcaggcccctcccac
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      ctcaggaggtgcacacttcatcaatttgaagaaagattgcattgtaattg
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E212_BCL2L11      ttctcatga-----------------------------------------
A0A2K6E212_BCL2L11      atcttacgactgttgcgttacattgtccgcctggtgtggagaatgcattg
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      atcttacgactgttgcgttacattgtccgcctggtgtggagaatgcattg
A0A2K6E212_BCL2L11      atcttacgactgttgcgttacattgtccgcctggtgtggagaatgcattg
A0A2K6E212_BCL2L11      atcttacgactgttgcgttacattgtccgcctggtgtggagaatgcattg
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       tgctgctggcgctgctca---------------gcgggggcctgcacctg
A0A2K6B5F6_BMF-01       tcctgcacaaccttgctttgaatggagaagagaaca-ggaacggggcggg
A0A2K6B5F6_BMF-02       tcctgcacaaccttgctttgaatggagaagagaaca-ggaacggggcggg
A0A2K6B5F6_BMF-04       tcctgcacaaccttgctttgaatggagaagagaaca-ggaacggggcggg
A0A2K6B5F6_BMF-03       tcctgcacaaccttgctttgaatggagaagagaaca-ggaacggggcggg
A0A2K6E7I4_BAD-02       -ccttccggtgcatgtga--------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-01       gtcttccagtcctggtgggatcggaacttgggcaggggaagctccgcacc
A0A2K6AYL7_HRK-01       -----------ctgctcg-------------gcaggcggaact-------
A0A2K6ASP2_BBC3-02      ctcctgacaccctggcca-------------gcgcgggggactttctctg
A0A2K6ASP2_BBC3-01      ctcctgacaccctggcca-------------gcgcgggggactttctctg
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      g-----------
A0A2K6BV43_PMAIP1-      ------------
A0A2K6E212_BCL2L11      ------------
A0A2K6E212_BCL2L11      a-----------
A0A2K6E212_BCL2L11      ------------
A0A2K6E212_BCL2L11      a-----------
A0A2K6E212_BCL2L11      a-----------
A0A2K6E212_BCL2L11      a-----------
A0A2K6E212_BCL2L11      ------------
A0A2K6E212_BCL2L11      ------------
A0A2K6E212_BCL2L11      ------------
A0A2K6E212_BCL2L11      ------------
A0A2K6DBJ4_BIK-01       ctgctcaagtga
A0A2K6B5F6_BMF-01       c--cctaggtga
A0A2K6B5F6_BMF-02       c--cctaggtga
A0A2K6B5F6_BMF-04       c--cctaggtga
A0A2K6B5F6_BMF-03       c--cctag----
A0A2K6E7I4_BAD-02       ------------
A0A2K6E7I4_BAD-03       ------------
A0A2K6E7I4_BAD-01       c--tcccagtga
A0A2K6AYL7_HRK-01       -------tgtag
A0A2K6ASP2_BBC3-02      c--accatgtag
A0A2K6ASP2_BBC3-01      c--accatgtag
A0A2K6ASP2_BBC3-03      ------------
                                    

© 1998-2020Legal notice