Dataset for CDS classical BH3-containing proteins of organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

24 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6BV43_PMAIP1-      atg-----------------------cctgggaag---------------
A0A2K6BV43_PMAIP1-      atg-----------------------cctgggaag---------------
A0A2K6E1Z6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E1Z6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E1Z6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E1Z6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E1Z6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E1Z6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E1Z6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E1Z6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E1Z6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6E1Z6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----gagaa
A0A2K6DBJ4_BIK-01       atg-----------------------tctggagtaaga------------
A0A2K6B5F6_BMF-01       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A2K6B5F6_BMF-02       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A2K6B5F6_BMF-04       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A2K6B5F6_BMF-03       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A2K6E7I4_BAD-02       atgttccag---------------atcccagagtttgagcctagtgagca
A0A2K6E7I4_BAD-01       atgttccag---------------atcccagagtttgagcctagtgagca
A0A2K6E7I4_BAD-03       atgttccag---------------atcccagagtttgagcctagtgagca
A0A2K6AYL7_HRK-01       atg--------------------------------t--------------
A0A2K6ASP2_BBC3-02      ataaaattt---------------ggcgtggggtct--------------
A0A2K6ASP2_BBC3-01      ataaaattt---------------ggcgtggggtct--------------
A0A2K6ASP2_BBC3-03      ataaaattt---------------ggcgtggggtct--------------
                        **                                                

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      ggtagacaattgcagcctgcg-----------------------------
A0A2K6E1Z6_BCL2L11      ggtagacaattgcagcctgcg-----------------------------
A0A2K6E1Z6_BCL2L11      ggtagacaattgcagcctgcg-----------------------------
A0A2K6E1Z6_BCL2L11      ggtagacaattgcagcctgcg-----------------------------
A0A2K6E1Z6_BCL2L11      ggtagacaattgcagcctgcg-----------------------------
A0A2K6E1Z6_BCL2L11      ggtagacaattgcagcctgcg-----------------------------
A0A2K6E1Z6_BCL2L11      ggtagacaattgcagcctgcg-----------------------------
A0A2K6E1Z6_BCL2L11      ggtagacaattgcagcctgcg-----------------------------
A0A2K6E1Z6_BCL2L11      ggtagacaattgcagcctgcg-----------------------------
A0A2K6E1Z6_BCL2L11      ggtagacaattgcagcctgcg-----------------------------
A0A2K6DBJ4_BIK-01       --------------cccatctccagagacaccttgatggagaccctcctg
A0A2K6B5F6_BMF-01       ggaggatgatgtgttccagccggaggac----------------------
A0A2K6B5F6_BMF-02       ggaggatgatgtgttccagccggaggac----------------------
A0A2K6B5F6_BMF-04       ggaggatgatgtgttccagccggaggac----------------------
A0A2K6B5F6_BMF-03       ggaggatgatgtgttccagccggaggac----------------------
A0A2K6E7I4_BAD-02       ggaagac-------tccagctctgcaga----------------------
A0A2K6E7I4_BAD-01       ggaagac-------tccagctctgcaga----------------------
A0A2K6E7I4_BAD-03       ggaagac-------tccagctctgcaga----------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      ---aaggcgcgcaagaacgcgcaacc------------------------
A0A2K6BV43_PMAIP1-      ---aaggcgcgcaagaacgcgcaacc------------------------
A0A2K6E1Z6_BCL2L11      ---gagaggcct-------ccccagctcag--------------------
A0A2K6E1Z6_BCL2L11      ---gagaggcct-------ccccagctcag--------------------
A0A2K6E1Z6_BCL2L11      ---gagaggcct-------ccccagctcag--------------------
A0A2K6E1Z6_BCL2L11      ---gagaggcct-------ccccagctcag--------------------
A0A2K6E1Z6_BCL2L11      ---gagaggcct-------ccccagctcag--------------------
A0A2K6E1Z6_BCL2L11      ---gagaggcct-------ccccagctcag--------------------
A0A2K6E1Z6_BCL2L11      ---gagaggcct-------ccccagctcag--------------------
A0A2K6E1Z6_BCL2L11      ---gagaggcct-------ccccagctcag--------------------
A0A2K6E1Z6_BCL2L11      ---gagaggcct-------ccccagctcag--------------------
A0A2K6E1Z6_BCL2L11      ---gagaggcct-------ccccagctcag--------------------
A0A2K6DBJ4_BIK-01       tatgagcagctcctggaacccctaaccatggaggttcttggtgtcactga
A0A2K6B5F6_BMF-01       ---ggggagccggggg----cccaacccgggag-----------ctcgct
A0A2K6B5F6_BMF-02       ---ggggagccggggg----cccaacccgggag-----------ctcgct
A0A2K6B5F6_BMF-04       ---ggggagccggggg----cccaacccgggag-----------ctcgct
A0A2K6B5F6_BMF-03       ---ggggagccggggg----cccaacccgggag-----------ctcgct
A0A2K6E7I4_BAD-02       ---gaggggcctgggc----cccagccccgcgggggacaggc-cctcaga
A0A2K6E7I4_BAD-01       ---gaggggcctgggc----cccagccccgcgggggacaggc-cctcaga
A0A2K6E7I4_BAD-03       ---gaggggcctgggc----cccagccccgcgggggacaggc-cctcaga
A0A2K6AYL7_HRK-01       --------gcccgtgc---cccctgcaccgc-------------------
A0A2K6ASP2_BBC3-02      --------gcccgggcatgtccatgccaggt-------------------
A0A2K6ASP2_BBC3-01      --------gcccgggcatgtccatgccaggt-------------------
A0A2K6ASP2_BBC3-03      --------gcccgggcatgtccatgccaggt-------------------
                                **           *   *                        

A0A2K6BV43_PMAIP1-      --------------------------------gagcc-------------
A0A2K6BV43_PMAIP1-      --------------------------------gagcc-------------
A0A2K6E1Z6_BCL2L11      ----------------------acctg-----gggcccctacctc-----
A0A2K6E1Z6_BCL2L11      ----------------------acctg-----gggcccctacctc-----
A0A2K6E1Z6_BCL2L11      ----------------------acctg-----gggcccctacctc-----
A0A2K6E1Z6_BCL2L11      ----------------------acctg-----gggcccctacctc-----
A0A2K6E1Z6_BCL2L11      ----------------------acctg-----gggcccctacctc-----
A0A2K6E1Z6_BCL2L11      ----------------------acctg-----gggcccctacctc-----
A0A2K6E1Z6_BCL2L11      ----------------------acctg-----gggcccctacctc-----
A0A2K6E1Z6_BCL2L11      ----------------------acctg-----gggcccctacctc-----
A0A2K6E1Z6_BCL2L11      ----------------------acctg-----gggcccctacctc-----
A0A2K6E1Z6_BCL2L11      ----------------------acctg-----gggcccctacctc-----
A0A2K6DBJ4_BIK-01       ccctgaagaggacctg------gaccctatggaggacttcgatcctttgg
A0A2K6B5F6_BMF-01       ctctgccgatctgttt------gccca-----gagcctacttgactgccc
A0A2K6B5F6_BMF-02       ctctgccgatctgttt------gccca-----gagcctacttgactgccc
A0A2K6B5F6_BMF-04       ctctgccgatctgttt------gccca-----gagcctacttgactgccc
A0A2K6B5F6_BMF-03       ctctgccgatctgttt------gccca-----gagcctacttgactgccc
A0A2K6E7I4_BAD-02       ctccggcaagcatcatcgccaggcccc-----aggcctcc----------
A0A2K6E7I4_BAD-01       ctccggcaagcatcatcgccaggcccc-----aggcctcc----------
A0A2K6E7I4_BAD-03       ctccggcaagcatcatcgccaggcccc-----aggcctcc----------
A0A2K6AYL7_HRK-01       ----------------------ggccg-----cggccccccggccgtgtg
A0A2K6ASP2_BBC3-02      ----------------------gccca-----gggcttct----------
A0A2K6ASP2_BBC3-01      ----------------------gccca-----gggcttct----------
A0A2K6ASP2_BBC3-03      ----------------------gccca-----gggcttct----------
                                                          *               

A0A2K6BV43_PMAIP1-      -------caacgcggg-----------ctcaggcag--------------
A0A2K6BV43_PMAIP1-      -------caacgcggg-----------ctcaggcaggaccggc-------
A0A2K6E1Z6_BCL2L11      --cctacagaca-gag----------ccaca-------------------
A0A2K6E1Z6_BCL2L11      --cctacagaca-gag----------ccacaaggtaatcccga-------
A0A2K6E1Z6_BCL2L11      --cctacagaca-gag----------ccacaaggtaatcccga-------
A0A2K6E1Z6_BCL2L11      --cctacagaca-gag----------ccacaaggtaatcccga-------
A0A2K6E1Z6_BCL2L11      --cctacagaca-gag----------ccacaaggtaatcccga-------
A0A2K6E1Z6_BCL2L11      --cctacagaca-ga-----------------------------------
A0A2K6E1Z6_BCL2L11      --cctacagaca-gag----------ccacaaggtaatcccga-------
A0A2K6E1Z6_BCL2L11      --cctacagaca-gag----------ccacaaggtaatcccga-------
A0A2K6E1Z6_BCL2L11      --cctacagaca-gag----------ccacaaggtaatcccga-------
A0A2K6E1Z6_BCL2L11      --cctacagaca-gag----------ccaca-------------------
A0A2K6DBJ4_BIK-01       agtgtatagaggacag----------tgacatgttggccctgc-------
A0A2K6B5F6_BMF-01       cctcagccgacttcagctcttccctctcacccactgctgtggc-------
A0A2K6B5F6_BMF-02       cctcagccgacttcagctcttccctctcacccactgctgtggc-------
A0A2K6B5F6_BMF-04       cctcagccgacttcagctcttccctctcacccactgctgtggc-------
A0A2K6B5F6_BMF-03       cctcagccgacttcagctcttccctctcacccactgctgtggc-------
A0A2K6E7I4_BAD-02       --tgtg-ggacgccag----------tcaccagcaggagcagc-------
A0A2K6E7I4_BAD-01       --tgtg-ggacgccag----------tcaccagcaggagcagc-------
A0A2K6E7I4_BAD-03       --tgtg-ggacgccag----------tcaccagcaggagcagc-------
A0A2K6AYL7_HRK-01       cgcctg-cagcgcggg----------tcgcttg---gggctgc-------
A0A2K6ASP2_BBC3-02      --tctg-cgacgtggg----------tcccctgccagatttgt-------
A0A2K6ASP2_BBC3-01      --tctg-cgacgtggg----------tcccctgccagatttgtggcccca
A0A2K6ASP2_BBC3-03      --tctg-cgacgtggg----------tcccctgccagatttgt-------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      gggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgt
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      agagggcctggcccgcgacggcccgcgccccttcccgctcggccgcctgg
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      tgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgcc
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      cccgccgcccccgccctgctgcccgctgcctacctctgcgcccccaccgc
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      cccacccgccgtcaccgccaccctggggggcccccgctggcctgggggtc
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      -----------------------------------------aggcaatca
A0A2K6E1Z6_BCL2L11      -----------------------------------------aggcaatca
A0A2K6E1Z6_BCL2L11      -----------------------------------------aggcaatca
A0A2K6E1Z6_BCL2L11      -----------------------------------------aggcaatca
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      -----------------------------------------aggcaatca
A0A2K6E1Z6_BCL2L11      -----------------------------------------aggcaatca
A0A2K6E1Z6_BCL2L11      -----------------------------------------aggcaatca
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       ------------------------------------------------cc
A0A2K6B5F6_BMF-02       ------------------------------------------------cc
A0A2K6B5F6_BMF-04       ------------------------------------------------cc
A0A2K6B5F6_BMF-03       ------------------------------------------------cc
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6AYL7_HRK-01       ------------------------------------------------gc
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      cccgcagccggccccgaggcccacgcccggacggtcctcagccctcgctc
A0A2K6ASP2_BBC3-03      --------------------------------ggtcctcagccctcgctc
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      ----------agggacggcagggacggcgagggaccaggccggattt---
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccc--------------
A0A2K6E1Z6_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccc--------------
A0A2K6E1Z6_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccc--------------
A0A2K6E1Z6_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccc--------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccc--------------
A0A2K6E1Z6_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccc--------------
A0A2K6E1Z6_BCL2L11      cggaggtgaaggggacagctgcccccacggcagccc--------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       -----ggctggcctgcatcggggac-------------------------
A0A2K6B5F6_BMF-01       tggccttcgacccaccagc-------------------------------
A0A2K6B5F6_BMF-02       tggccttcgacccaccagc-------------------------------
A0A2K6B5F6_BMF-04       tggccttcgacccaccagc-------------------------------
A0A2K6B5F6_BMF-03       tggccttcgacccaccagc-------------------------------
A0A2K6E7I4_BAD-02       --------caaccagcagcagccatcatggagggacttcct---------
A0A2K6E7I4_BAD-01       --------caaccagcagcagccatcatgg--------------------
A0A2K6E7I4_BAD-03       --------caaccagcagcagccatcatggagggagagcttggtattctc
A0A2K6AYL7_HRK-01       tcgtccgccgcgcagc--------tcaccgccgcccggc-----------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      ttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggc
A0A2K6ASP2_BBC3-03      ttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggc
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6E7I4_BAD-03       cttcttgggaatctgaggactctgaaaatcccagtgcaaggatgctcgcg
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      cctggcgggcgg--------------------------------------
A0A2K6ASP2_BBC3-03      cctggcgggcgg--------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       ------------------------------------------------cg
A0A2K6E7I4_BAD-01       --------------------------------------------------
A0A2K6E7I4_BAD-03       gaagcatcagcacggatgtctgccccagccactgactcagaagcccaaca
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      --------------------tcccacccaggcggccccgggagtccgcgg
A0A2K6ASP2_BBC3-03      --------------------tcccacccaggcggccccgggagtccgcgg
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      -gggattgggatgcagctgcattacaccagaggcaaaaagctcgtctcct
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      -----------------tcagggcccgctggccccaccggccagccctgg
A0A2K6E1Z6_BCL2L11      -----------------tcagggcccgctggccccaccggccagccctgg
A0A2K6E1Z6_BCL2L11      -----------------tcagggcccgctggccccaccggccagccctgg
A0A2K6E1Z6_BCL2L11      -----------------tcagggcccgctggccccaccggccagccctgg
A0A2K6E1Z6_BCL2L11      --------------------------------------------ccctgg
A0A2K6E1Z6_BCL2L11      -----------------tcagggcccgctggccccaccggccagccctgg
A0A2K6E1Z6_BCL2L11      -----------------tcagggcccgctggccccaccggccagccctgg
A0A2K6E1Z6_BCL2L11      -----------------tcagggcccgctggccccaccggccagccctgg
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       -gagatggatgtgagcctcagggccccgcgcctggcccagctctctgagg
A0A2K6B5F6_BMF-01       -caggaagacaaggccacccagaccctcggc-------------------
A0A2K6B5F6_BMF-02       -caggaagacaaggccacccagaccctcggc-------------------
A0A2K6B5F6_BMF-04       -caggaagacaaggccacccagaccctcggc-------------------
A0A2K6B5F6_BMF-03       -caggaagacaaggccacccagaccctcggc-------------------
A0A2K6E7I4_BAD-02       cccgaagagcgcgggcacagcgacgcagatgcggcaaagctccagctgga
A0A2K6E7I4_BAD-01       --------------------aggcgctggggctgtggagacccg--cagt
A0A2K6E7I4_BAD-03       cgcagagaatgtaaagctgaaggcgctggggctgtggagacccg--cagt
A0A2K6AYL7_HRK-01       -----------------tcaaggcgcttggcgacgagctgc---------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      ggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatgg
A0A2K6ASP2_BBC3-03      ggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatgg
                                                                          

A0A2K6BV43_PMAIP1-      ----------------------------------------------agct
A0A2K6BV43_PMAIP1-      cctccccacttgtccttccgcggggccacgaggaacaagtgcaagtagct
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      cccttttgctaccagatccccgcttttcatctttatgagaagatcctccc
A0A2K6E1Z6_BCL2L11      cccttttgctaccagatccccgcttttcatctttatgagaagatcctccc
A0A2K6E1Z6_BCL2L11      cccttttgctaccagatccccgcttttcatctttatgagaagatcctccc
A0A2K6E1Z6_BCL2L11      cccttttgctaccagatccccgcttttcatctttatgagaagatcctccc
A0A2K6E1Z6_BCL2L11      cccttttgctaccagatcccc-----------------------------
A0A2K6E1Z6_BCL2L11      cccttttgctaccagatccccgcttttcatctttatgagaagatcctccc
A0A2K6E1Z6_BCL2L11      cccttttgctaccagatccccgcttttcatctttatgagaagatcctccc
A0A2K6E1Z6_BCL2L11      cccttttgctaccagatccccgcttttcatctttatgagaagatcctccc
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6DBJ4_BIK-01       tggccatgcacagcc-----tgggtctggctttcatctacgacca-----
A0A2K6B5F6_BMF-01       --ccagcctcccccagccaaggtgtcatgctgccttgtggggtaa-----
A0A2K6B5F6_BMF-02       --ccagcctcccccagccaaggtgtcatgctgccttgtggggtaa-----
A0A2K6B5F6_BMF-04       --ccagcctcccccagccaaggtgtcatgctgccttgtggggtaa-----
A0A2K6B5F6_BMF-03       --ccagcctcccccagccaaggtgtcatgctgccttgtggggtaa-----
A0A2K6E7I4_BAD-02       cgcgagtcttccagtcctggtgggatcg--------gaacttggg-----
A0A2K6E7I4_BAD-01       cgccacagctcctaccccgcggggacggaggaggacgaagggatg-----
A0A2K6E7I4_BAD-03       cgccacagctcctaccccgcggggacggaggaggacgaagggatg-----
A0A2K6AYL7_HRK-01       ----------------------------------accagcgcacc-----
A0A2K6ASP2_BBC3-02      -------------------------------gagacaagaggagc-----
A0A2K6ASP2_BBC3-01      cggacgacctcaacgcgcaatacgagcggcggagacaagaggagc-----
A0A2K6ASP2_BBC3-03      cggacgacctcaacgcgcaatacgagcggcggagacaagaggagc-----
                                                                          

A0A2K6BV43_PMAIP1-      cgaagtcg--------------------------------agtgtgctac
A0A2K6BV43_PMAIP1-      cgaagtcg--------------------------------agtgtgctac
A0A2K6E1Z6_BCL2L11      ----------------------------------------agacaggagc
A0A2K6E1Z6_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A2K6E1Z6_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A2K6E1Z6_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A2K6E1Z6_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A2K6E1Z6_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A2K6E1Z6_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A2K6E1Z6_BCL2L11      ----------------------------------------agacaggagc
A0A2K6DBJ4_BIK-01       ----------------------------------------gatggacgac
A0A2K6B5F6_BMF-01       ----------------------------------------ctgaggaacc
A0A2K6B5F6_BMF-02       ----------------------------------------ctgaggaacc
A0A2K6B5F6_BMF-04       ----------------------------------------ctgaggaacc
A0A2K6B5F6_BMF-03       ----------------------------------------ctgaggaacc
A0A2K6E7I4_BAD-02       ----------------------------------------caggggaagc
A0A2K6E7I4_BAD-01       ----------------------------------------gaggaggagc
A0A2K6E7I4_BAD-03       ----------------------------------------gaggaggagc
A0A2K6AYL7_HRK-01       ----------------------------------------atgtggcggc
A0A2K6ASP2_BBC3-02      ----------------------------------------a-gcagcgac
A0A2K6ASP2_BBC3-01      ----------------------------------------a-gcagcgac
A0A2K6ASP2_BBC3-03      ----------------------------------------a-gcagcgac
                                                                          

A0A2K6BV43_PMAIP1-      tcaactcaggagatttggagaca----------aactaaac---------
A0A2K6BV43_PMAIP1-      tcaactcaggagatttggagaca----------aactaaac---------
A0A2K6E1Z6_BCL2L11      ccagcacccatgagttgtgacaa----------atcaacacaaaccccaa
A0A2K6E1Z6_BCL2L11      ccagcacccatgagttgtgacaa----------atcaacacaaaccccaa
A0A2K6E1Z6_BCL2L11      ccagcacccatgagttgtgacaa----------atcaacacaaaccccaa
A0A2K6E1Z6_BCL2L11      ccagcacccatgagttgtgacaa----------atcaacacaaaccccaa
A0A2K6E1Z6_BCL2L11      ccagcacccatgagttgtgacaa----------atcaacacaaaccccaa
A0A2K6E1Z6_BCL2L11      --------------ttgtgacaa----------atcaacacaaaccccaa
A0A2K6E1Z6_BCL2L11      ccagcacccatgagttgtgacaa----------atcaacacaaaccccaa
A0A2K6E1Z6_BCL2L11      ccagcacccatgagttgtgacaa----------atcaacacaaaccccaa
A0A2K6E1Z6_BCL2L11      ccagcacccatgagttgtgacaa----------atcaacacaaaccccaa
A0A2K6E1Z6_BCL2L11      ccagcacccatgagttgtgacaa----------atcaacacaaaccccaa
A0A2K6DBJ4_BIK-01       atcagggatgttcttagaagtttcatggatggtttcaccac---------
A0A2K6B5F6_BMF-01       ccagcgactcttttacggcaatgctggct----accggctt---------
A0A2K6B5F6_BMF-02       ccagcgactcttttacggcaatgctggct----accggctt---------
A0A2K6B5F6_BMF-04       ccagcgactcttttacggcaatgctggct----accggctt---------
A0A2K6B5F6_BMF-03       ccagcgactcttttacg---------------------------------
A0A2K6E7I4_BAD-02       tccgcaccc---tcccagtgacctt--cg----ctccacgc---------
A0A2K6E7I4_BAD-01       ccagc-ccc---tttcggggccgctcgcg----ctccgcgc---------
A0A2K6E7I4_BAD-03       ccagc-ccc---tttcggggccgctcgcg----ctccgcgc---------
A0A2K6AYL7_HRK-01       gccgcgcgcggagccggagggcgccggcg----cccggcgc---------
A0A2K6ASP2_BBC3-02      accgcccctcgccctggagg--------g----tcctgtac---------
A0A2K6ASP2_BBC3-01      accgcccctcgccctggagg--------g----tcctgtac---------
A0A2K6ASP2_BBC3-03      accgcccctcgccctggagg--------g----tcctgtac---------
                                                                          

A0A2K6BV43_PMAIP1-      -----------------ttccggcagaaacttctgaatctgatagccaaa
A0A2K6BV43_PMAIP1-      -----------------ttccggcagaaacttctgaatctgatagccaaa
A0A2K6E1Z6_BCL2L11      gtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca--
A0A2K6E1Z6_BCL2L11      gtcctccttgccaggccttcaaccactatctcagtgcaatggcttccagg
A0A2K6E1Z6_BCL2L11      gtcctccttgccaggccttcaaccactatctcagtgcaatggcttccagg
A0A2K6E1Z6_BCL2L11      gtcctccttgccaggccttcaaccactatctcagtgcaatggctaactgg
A0A2K6E1Z6_BCL2L11      gtcctccttgccaggccttcaaccactatctcagtgcaatggtt------
A0A2K6E1Z6_BCL2L11      gtcctccttgccaggccttcaaccactatctcagtgcaatggcttccagg
A0A2K6E1Z6_BCL2L11      gtcctccttgccaggccttcaaccactatctcagtgcaat----------
A0A2K6E1Z6_BCL2L11      gtcctccttgccaggccttcaaccactatctcagtgcaatggcttccagg
A0A2K6E1Z6_BCL2L11      gtcctccttgccaggccttcaaccactatctcagtgcaatggcttccagg
A0A2K6E1Z6_BCL2L11      gtcctccttgccaggccttcaaccactatctcagtgcaatggcttccagg
A0A2K6DBJ4_BIK-01       -----ccttagggagaacataatgaggttctggagatccccgaatcccag
A0A2K6B5F6_BMF-01       -----cctctccctgccagtttcccggcagtcttgcccatcggggagcag
A0A2K6B5F6_BMF-02       -----cctctccctgccagtttcccggcagtcttgcccatcggggagcag
A0A2K6B5F6_BMF-04       -----cctctccctgccagtttcccggcagtcttgcccatcggggagcag
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       -----ccggaaactccacccgct------ctcactgtcctcgtcggccat
A0A2K6E7I4_BAD-01       -----cc----------cccaac------ctc------------------
A0A2K6E7I4_BAD-03       -----cc----------cccaac------ctc------------------
A0A2K6AYL7_HRK-01       -----gct---------ccccac------ctactggccctggctg-----
A0A2K6ASP2_BBC3-02      -----aat---------ctcatcatgggactcctgcccttaccca-----
A0A2K6ASP2_BBC3-01      -----aat---------ctcatcatgggactcctgcccttaccca-----
A0A2K6ASP2_BBC3-03      -----aat---------ctcatcatgggactcctgcccttaccca-----
                                                                          

A0A2K6BV43_PMAIP1-      -------------------------------------------ctcttct
A0A2K6BV43_PMAIP1-      -------------------------------------------ctcttct
A0A2K6E1Z6_BCL2L11      ------------------------tcctagaggatatag-----------
A0A2K6E1Z6_BCL2L11      aggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaaga
A0A2K6E1Z6_BCL2L11      aggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaaga
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      -----------------------------agagaaataga----------
A0A2K6E1Z6_BCL2L11      aggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaaga
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      aggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaaga
A0A2K6E1Z6_BCL2L11      aggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaaga
A0A2K6E1Z6_BCL2L11      aggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaaga
A0A2K6DBJ4_BIK-01       gtcc----tgggt------------------------------gtcccgt
A0A2K6B5F6_BMF-01       ccccccgaagggcagtggcaacatcgagcagaggtacagattgcccgaaa
A0A2K6B5F6_BMF-02       ccccccgaagggcagtggcaacatcgagcagaggtacagattgcccgaaa
A0A2K6B5F6_BMF-04       ccccccgaagggcagtggcaacatcgagcagaggtacagattgcccgaaa
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       cttggatatgggc-------------ggaagtgcttccctcaggccttat
A0A2K6E7I4_BAD-01       --------tgggc-------------agcacagcgt---tatggccgcga
A0A2K6E7I4_BAD-03       --------tgggc-------------agcacagcgt---tatggccgcga
A0A2K6AYL7_HRK-01       --------tgcgc-------------ggccgcgc----------------
A0A2K6ASP2_BBC3-02      --------ggggc-------------cacagagcccccgaaatggagccc
A0A2K6ASP2_BBC3-01      --------ggggc-------------cacagagcccccgaaatggagccc
A0A2K6ASP2_BBC3-03      --------ggggc-------------cacagagcccccgaaatggagccc
                                                                          

A0A2K6BV43_PMAIP1-      gctcaggaacctg-------------------------------------
A0A2K6BV43_PMAIP1-      gctcaggaacctg-------------------------------------
A0A2K6E1Z6_BCL2L11      gtgatagttcattgtggtttggatttata---------------------
A0A2K6E1Z6_BCL2L11      gttgcggcgaatcggagacgagtttaacg---------------------
A0A2K6E1Z6_BCL2L11      gttgcggcgaatcggagacgagtttaacg---------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      gttgcggcgaatcggagacgagtttaacg---------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      gttgcggcgaatcggagacgagtttaacg---------------------
A0A2K6E1Z6_BCL2L11      gttgcggcgaatcggagacgagtttaacg---------------------
A0A2K6E1Z6_BCL2L11      gttgcggcgaatcggagacgagtttaacg---------------------
A0A2K6DBJ4_BIK-01       gaacaggtgctgctg-----------------------------------
A0A2K6B5F6_BMF-01       gcttcagtgcattgcagaccagttccaccggctccatgtgcagc------
A0A2K6B5F6_BMF-02       gcttcagtgcattgcagaccagttccaccggctccatgtgcagc------
A0A2K6B5F6_BMF-04       gcttcagtgcattgcagaccagttccaccggctccatgtgcagc------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K6E7I4_BAD-02       gcaaaagaggatccgtgctgcctctttcg---------------------
A0A2K6E7I4_BAD-01       gctccggaggatgagtgacgagtttgtggactcctttaagggacttcctc
A0A2K6E7I4_BAD-03       gctccggaggatga------------------------------------
A0A2K6AYL7_HRK-01       ----aggtggcggcg-----------------------------------
A0A2K6ASP2_BBC3-02      aattaggtgcctgca-----------------------------------
A0A2K6ASP2_BBC3-01      aattaggtgcctgca-----------------------------------
A0A2K6ASP2_BBC3-03      aattag--------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      -----------a--------------------------------------
A0A2K6BV43_PMAIP1-      -----------actgcatcaaaaacttgcataaggggactccaaaagaga
A0A2K6E1Z6_BCL2L11      ------------------------------------------------tt
A0A2K6E1Z6_BCL2L11      ------------------------------------------------ct
A0A2K6E1Z6_BCL2L11      ------------------------------------------------ct
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      ------------------------------------------------ct
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      ------------------------------------------------ct
A0A2K6E1Z6_BCL2L11      ------------------------------------------------ct
A0A2K6E1Z6_BCL2L11      ------------------------------------------------ct
A0A2K6DBJ4_BIK-01       ----------------------------------gtgctgctgctgctgc
A0A2K6B5F6_BMF-01       -----------aacaccagcagaaccgaaatcgcgtgtggtggcagatcc
A0A2K6B5F6_BMF-02       -----------aacaccagcagaaccgaaatcgcgtgtggtggcagatcc
A0A2K6B5F6_BMF-04       -----------aacaccagcagaaccgaaatcgcgtgtggtggcagatcc
A0A2K6B5F6_BMF-03       -------------caccagcagaaccgaaatcgcgtgtggtggcagatcc
A0A2K6E7I4_BAD-02       -----------gtgggagggctgacccagattc-----------------
A0A2K6E7I4_BAD-01       gcccgaagagcgcgggcacagcgacgcagatgcggcaaagctccagctgg
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6AYL7_HRK-01       -----------ctggcggcctgg---------------------------
A0A2K6ASP2_BBC3-02      -----------cccgcccggtggacgtcagggactcggggggcaggcccc
A0A2K6ASP2_BBC3-01      -----------cccgcccggtggacgtcagggactcggggggcaggcccc
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      ctttttctcaggaggtgcacacttcatcaatttgaagaaagattgcattg
A0A2K6E1Z6_BCL2L11      tactggcttagatttgtatggccaccaccacagtca------agatacag
A0A2K6E1Z6_BCL2L11      tactatgcaaggaggatgtcgcttccacctgattaa--------------
A0A2K6E1Z6_BCL2L11      tactatgcaaggaggttagag---------aaatag--------------
A0A2K6E1Z6_BCL2L11      ------------------------------gactag--------------
A0A2K6E1Z6_BCL2L11      -------------ggaagttgtc-------gtgtag--------------
A0A2K6E1Z6_BCL2L11      tactatgcaaggagggtattttt-------gaataattaccaagcagccg
A0A2K6E1Z6_BCL2L11      -------------gggtattttt-------gaataa--------------
A0A2K6E1Z6_BCL2L11      tactatgcaaggagggtattttt-------gaataattaccaagcagccg
A0A2K6E1Z6_BCL2L11      tactatgcaaggagggtattttt-------gaataattaccaagcagccg
A0A2K6E1Z6_BCL2L11      tactatgcaaggagggtattttt-------gaataattaccaagcagccg
A0A2K6DBJ4_BIK-01       tggcactgctgctggcgctgctca---------------gcgggggcctg
A0A2K6B5F6_BMF-01       tcctcttcctgcacaaccttgctttgaatggagaagagaaca-ggaacgg
A0A2K6B5F6_BMF-02       tcctcttcctgcacaaccttgctttgaatggagaagagaaca-ggaacgg
A0A2K6B5F6_BMF-04       tcctcttcctgcacaaccttgctttgaatggagaagagaaca-ggaacgg
A0A2K6B5F6_BMF-03       tcctcttcctgcacaaccttgctttgaatggagaagagaaca-ggaacgg
A0A2K6E7I4_BAD-02       -------ccttccggtgcatgtga--------------------------
A0A2K6E7I4_BAD-01       acgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctc
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6AYL7_HRK-01       -----------------ctgctcg-------------gcaggcggaact-
A0A2K6ASP2_BBC3-02      tcccacctcctgacaccctggcca-------------gcgcgggggactt
A0A2K6ASP2_BBC3-01      tcccacctcctgacaccctggcca-------------gcgcgggggactt
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      taattgg-------------------------------------------
A0A2K6E1Z6_BCL2L11      aacaactcaaccacaaggatttctcatga---------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      aagaccacccacaaatggttatcttacgactgttgcgttacattgtccgc
A0A2K6E1Z6_BCL2L11      --------------------------------------------------
A0A2K6E1Z6_BCL2L11      aagaccacccacaaatggttatcttacgactgttgcgttacattgtccgc
A0A2K6E1Z6_BCL2L11      aagaccacccacaaatggttatcttacgactgttgcgttacattgtccgc
A0A2K6E1Z6_BCL2L11      aagaccacccacaaatggttatcttacgactgttgcgttacattgtccgc
A0A2K6DBJ4_BIK-01       cacctgctgctcaagtga--------------------------------
A0A2K6B5F6_BMF-01       ggcgggc--cctaggtga--------------------------------
A0A2K6B5F6_BMF-02       ggcgggc--cctaggtga--------------------------------
A0A2K6B5F6_BMF-04       ggcgggc--cctaggtga--------------------------------
A0A2K6B5F6_BMF-03       ggcgggc--cctag------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-01       cgcaccc--tcccagtga--------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K6AYL7_HRK-01       -------------tgtag--------------------------------
A0A2K6ASP2_BBC3-02      tctctgc--accatgtag--------------------------------
A0A2K6ASP2_BBC3-01      tctctgc--accatgtag--------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6BV43_PMAIP1-      ---------------------
A0A2K6BV43_PMAIP1-      ---------------------
A0A2K6E1Z6_BCL2L11      ---------------------
A0A2K6E1Z6_BCL2L11      ---------------------
A0A2K6E1Z6_BCL2L11      ---------------------
A0A2K6E1Z6_BCL2L11      ---------------------
A0A2K6E1Z6_BCL2L11      ---------------------
A0A2K6E1Z6_BCL2L11      ctggtgtggagaatgcattga
A0A2K6E1Z6_BCL2L11      ---------------------
A0A2K6E1Z6_BCL2L11      ctggtgtggagaatgcattga
A0A2K6E1Z6_BCL2L11      ctggtgtggagaatgcattga
A0A2K6E1Z6_BCL2L11      ctggtgtggagaatgcattga
A0A2K6DBJ4_BIK-01       ---------------------
A0A2K6B5F6_BMF-01       ---------------------
A0A2K6B5F6_BMF-02       ---------------------
A0A2K6B5F6_BMF-04       ---------------------
A0A2K6B5F6_BMF-03       ---------------------
A0A2K6E7I4_BAD-02       ---------------------
A0A2K6E7I4_BAD-01       ---------------------
A0A2K6E7I4_BAD-03       ---------------------
A0A2K6AYL7_HRK-01       ---------------------
A0A2K6ASP2_BBC3-02      ---------------------
A0A2K6ASP2_BBC3-01      ---------------------
A0A2K6ASP2_BBC3-03      ---------------------
                                             

© 1998-2021Legal notice