Dataset for CDS BCL2L11 of organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6E212_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6E212_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2K6E212_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K6E212_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                        **************************************************

A0A2K6E212_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K6E212_BCL2L11      cctccctacagacagagccaca----------------------------
                        **********************                            

A0A2K6E212_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K6E212_BCL2L11      --------------------------------------------------
                                                                          

A0A2K6E212_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K6E212_BCL2L11      --------------------------------------------------
                                                                          

A0A2K6E212_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6E212_BCL2L11      --------------------------------------------------
                                                                          

A0A2K6E212_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6E212_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                          ************************************************

A0A2K6E212_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K6E212_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
                        **************************************************

A0A2K6E212_BCL2L11      ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
A0A2K6E212_BCL2L11      ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
                        **************************************************

A0A2K6E212_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggat
A0A2K6E212_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
                        ************************************************ *

A0A2K6E212_BCL2L11      gtcgct--------------------------------------------
A0A2K6E212_BCL2L11      atttttgaataattaccaagcagccgaagaccacccacaaatggttatct
                         *   *                                            

A0A2K6E212_BCL2L11      ---------------------tccacctg-------------attaa
A0A2K6E212_BCL2L11      tacgactgttgcgttacattgtccgcctggtgtggagaatgcattga
                                             *** ****             *** *

© 1998-2020Legal notice