Dataset for CDS BMF of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F7ZML1_BMF-01      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
A0A5F7ZML1_BMF-02      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
A0A5F7ZML1_BMF-03      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
                       **************************************************

A0A5F7ZML1_BMF-01      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc
A0A5F7ZML1_BMF-02      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc
A0A5F7ZML1_BMF-03      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc
                       **************************************************

A0A5F7ZML1_BMF-01      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
A0A5F7ZML1_BMF-02      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
A0A5F7ZML1_BMF-03      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
                       **************************************************

A0A5F7ZML1_BMF-01      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A5F7ZML1_BMF-02      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A5F7ZML1_BMF-03      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
                       **************************************************

A0A5F7ZML1_BMF-01      caaggccacccagaccctcggcccagcctcccccagccaaggtgtcatgc
A0A5F7ZML1_BMF-02      caaggccacccagaccctcggcccagcctcccccagccaaggtgtcatgc
A0A5F7ZML1_BMF-03      caaggccacccagaccctcggcccagcctcccccagccaaggtgtcatgc
                       **************************************************

A0A5F7ZML1_BMF-01      tgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgct
A0A5F7ZML1_BMF-02      tgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgct
A0A5F7ZML1_BMF-03      tgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgct
                       **************************************************

A0A5F7ZML1_BMF-01      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
A0A5F7ZML1_BMF-02      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
A0A5F7ZML1_BMF-03      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
                       **************************************************

A0A5F7ZML1_BMF-01      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
A0A5F7ZML1_BMF-02      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
A0A5F7ZML1_BMF-03      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
                       **************************************************

A0A5F7ZML1_BMF-01      cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcag
A0A5F7ZML1_BMF-02      cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcag
A0A5F7ZML1_BMF-03      cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcag
                       **************************************************

A0A5F7ZML1_BMF-01      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
A0A5F7ZML1_BMF-02      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
A0A5F7ZML1_BMF-03      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
                       **************************************************

A0A5F7ZML1_BMF-01      gcacaaccttgctttgaatggagaacagaacaggaacggggcgggcccta
A0A5F7ZML1_BMF-02      gcacaaccttgctttgaatggagaacagaacaggaacggggcgggcccta
A0A5F7ZML1_BMF-03      gcacaaccttgctttgaatggagaacagaacaggaacggggcgggcccta
                       **************************************************

A0A5F7ZML1_BMF-01      ggcccctgacctggaatggggctgttgtcaaaccctgttga
A0A5F7ZML1_BMF-02      gg------------------------------------tga
A0A5F7ZML1_BMF-03      gg------------------------------------tga
                       **                                    ***

© 1998-2022Legal notice