Dataset for CDS BMF of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7CM09_BMF-01      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggg
F7CM09_BMF-03      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggg
F7CM09_BMF-02      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggg
                   ************************************************************

F7CM09_BMF-01      gagccgggggcccaacccgggagctcgctctctgccgatctgtttgcccagagcctactt
F7CM09_BMF-03      gagccgggggcccaacccgggagctcgctctctgccgatctgtttgcccagagcctactt
F7CM09_BMF-02      gagccgggggcccaacccgggagctcgctctctgccgatctgtttgcccagagcctactt
                   ************************************************************

F7CM09_BMF-01      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
F7CM09_BMF-03      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
F7CM09_BMF-02      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
                   ************************************************************

F7CM09_BMF-01      cgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
F7CM09_BMF-03      cgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
F7CM09_BMF-02      cgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
                   ************************************************************

F7CM09_BMF-01      ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgct
F7CM09_BMF-03      ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgct
F7CM09_BMF-02      ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgct
                   ************************************************************

F7CM09_BMF-01      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcggggagcagccc
F7CM09_BMF-03      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcggggagcagccc
F7CM09_BMF-02      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcggggagcagccc
                   ************************************************************

F7CM09_BMF-01      cccgaagggcagtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcatt
F7CM09_BMF-03      cccgaagggcagtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcatt
F7CM09_BMF-02      cccgaagggcagtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcatt
                   ************************************************************

F7CM09_BMF-01      gcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
F7CM09_BMF-03      gcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
F7CM09_BMF-02      gcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
                   ************************************************************

F7CM09_BMF-01      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaacagaacaggaacggg
F7CM09_BMF-03      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaacagaacaggaacggg
F7CM09_BMF-02      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaacagaacaggaacggg
                   ************************************************************

F7CM09_BMF-01      gcgggccctaggcccctgacctggaatggggctgttgtcaaaccctgttga
F7CM09_BMF-03      gcgggccctagg------------------------------------tga
F7CM09_BMF-02      gcgggccctagg------------------------------------tga
                   ************                                    ***

© 1998-2020Legal notice