Dataset for CDS BAD of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5VCA1_BAD-01      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
Q2PG01_BAD-01          --------------------------------------------------
                                                                         

A0A2K5VCA1_BAD-01      tgcagagaggggcctgggccccagccccgcggggaacaggccctcagact
Q2PG01_BAD-01          --------------------------------------------------
                                                                         

A0A2K5VCA1_BAD-01      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
Q2PG01_BAD-01          --------------------------------------------------
                                                                         

A0A2K5VCA1_BAD-01      cagcaggagcagccaaccagcagcagccatcatggaggcgctggggctgt
Q2PG01_BAD-01          --------------------------------------------------
                                                                         

A0A2K5VCA1_BAD-01      ggagacccggagtcgccacagctcctaccccgcggggacggaggaggacg
Q2PG01_BAD-01          --------------------------------------------------
                                                                         

A0A2K5VCA1_BAD-01      aagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcg
Q2PG01_BAD-01          -----atggaggaggagcccagcccctttcggggccgctcgcgctccgcg
                            *********************************************

A0A2K5VCA1_BAD-01      ccccccaacctctgggcagcacagcgttatggccgcgagctccggaggat
Q2PG01_BAD-01          ccccccaacctctgggcagcacagcgttatggccgcgagctccggaggat
                       **************************************************

A0A2K5VCA1_BAD-01      gagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
Q2PG01_BAD-01          gagtgacgagtttgtggactcctttaaggggcttcctcgcccgaagagcg
                       ****************************** *******************

A0A2K5VCA1_BAD-01      cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttc
Q2PG01_BAD-01          cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttc
                       **************************************************

A0A2K5VCA1_BAD-01      cagtcctggtgggatcggaacttgggcaggggaagctccgcaccctccca
Q2PG01_BAD-01          cagtcctggtgggatcggaacttgggcaggggaagctccgcaccctccca
                       **************************************************

A0A2K5VCA1_BAD-01      gtga
Q2PG01_BAD-01          gtga
                       ****

© 1998-2022Legal notice