Dataset for CDS BAD of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5VCA9_BAD-03      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2K5VCA9_BAD-02      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
Q2PG01_BAD-01          atgg------------------------------aggaggagcccagccc
                       ***                               **** **  ***** *

A0A2K5VCA9_BAD-03      tgcagagaggggcctgggccccagccccgcgggggacaggccctcagact
A0A2K5VCA9_BAD-02      tgcagagaggggcctgggccccagccccgcgggggacaggccctcagact
Q2PG01_BAD-01          ctt---tcggggcc---gctcgcgctccgc--------gccccccaacct
                               ******   ** *  ** ****        * *** **  **

A0A2K5VCA9_BAD-03      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2K5VCA9_BAD-02      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
Q2PG01_BAD-01          ctgggcagca-cagcgttatggccgcgagctccggagg------------
                       * **  **** ** **  * * **  *  **** * **            

A0A2K5VCA9_BAD-03      cagcaggagcagccaaccagcagcagccatcatggagggagagcttggta
A0A2K5VCA9_BAD-02      cagcaggagcagccaaccagcagcagccatcatggaggga----------
Q2PG01_BAD-01          ----atgagtgacgagtttgtggactccttta---agggg----------
                           * ***   * *    *  *   ** * *   ****           

A0A2K5VCA9_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc
A0A2K5VCA9_BAD-02      -----cttcctcg---cccgaaga--------------------------
Q2PG01_BAD-01          -----cttcctcg---cccgaaga--------------------------
                            **** * *    * ** **                          

A0A2K5VCA9_BAD-03      tcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcc
A0A2K5VCA9_BAD-02      gcgcgggcacagcgacgcagat----------------------------
Q2PG01_BAD-01          gcgcgggcacagcgacgcagat----------------------------
                        *****   ** *  * * ***                            

A0A2K5VCA9_BAD-03      caacacgcagagaatgtaaagctgaaggcgctggggctgtggagacccgg
A0A2K5VCA9_BAD-02      ------gcggcaaagctccagctggacgc--------------------g
Q2PG01_BAD-01          ------gcggcaaagctccagctggacgc--------------------g
                             ** *  **  *  ***** * **                    *

A0A2K5VCA9_BAD-03      agtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
A0A2K5VCA9_BAD-02      agtc-------ttccagtcctggtgggatcg--------gaacttgggca
Q2PG01_BAD-01          agtc-------ttccagtcctggtgggatcg--------gaacttgggca
                       ****        ***   ** *  ****  *        ***     * *

A0A2K5VCA9_BAD-03      ggaggagcccagc-ccctttcggggccgctcgcgctccgcgc--------
A0A2K5VCA9_BAD-02      ggggaagctccgcaccctcccagtgaccttcgctccacgcccggaaactc
Q2PG01_BAD-01          ggggaagctccgcaccctcccagtga------------------------
                       ** * *** * ** ****  * * *                         

A0A2K5VCA9_BAD-03      --------------------------------------------------
A0A2K5VCA9_BAD-02      cacccgctctcactgtcctggtcggccatcttggatatgggcggaagtgc
Q2PG01_BAD-01          --------------------------------------------------
                                                                         

A0A2K5VCA9_BAD-03      --cccccaacctctgggcagcacagcgttatggccgcgagctccggagga
A0A2K5VCA9_BAD-02      ttccctcaggccttatgcaaaagaggatccgtgctgcctctttcggtggg
Q2PG01_BAD-01          --------------------------------------------------
                                                                         

A0A2K5VCA9_BAD-03      tga-------------------------------
A0A2K5VCA9_BAD-02      agggctgacccagattcccttccggtgcatgtga
Q2PG01_BAD-01          ----------------------------------
                                                         

© 1998-2020Legal notice